来源
2002-11-20 12:28:00

一个在两性都表达的基因为什么只对雌性

这个故事是性别和转录因子的关系。 果蝇性别的机理是所有动物里分子机理研究最透彻(也许C elegans比较接近) 以前特别有趣的是果蝇性别决定有几个步骤是条件mRNA间接 这里研究的是intersex基因,已知它只对雌性重要,Baker实验室克隆出它后发现它和转录因 子有序列相似,它在雌雄两性都表达,为什么?Baker等研究认为intersex要和另外一个基因 doublesex的产物一道起功能,而doublesex有雌性和雄性特有的两个不同产物,intersex只 和其中雌性特有的doublesex产物DBXF结合,所以他们认为intersex是DBXF条件转录的辅助因 子。 Development 129, 4661-4675 (2002) intersex, a gene required for female sexual development in Drosophila, is expres sed in both sexes and functions together with doublesex to regulate terminal dif ferentiation Carrie M. Garrett-Engele1,2,*,, Mark L. Siegal1,,, Devanand S. Manoli1, Byron C. Williams3, Hao Li1, and Bruce S. Baker1 1 Department of Biological Sciences, Stanford University, Stanford, CA 94305-502 0, USA 2 Department of Developmental Biology, Stanford University School of Medicine, S tanford, CA 94305, USA 3 Department of Molecular Biology and Genetics, Biotechnology Building, Cornell University, Ithaca, NY 14853-2703, USA * Present address: Howard Hughes Medical Institute and Division of Basic Science s, Fred Hutchinson Cancer Research Center, Seattle, WA 98109, USA Present address: Department of Functional Genomics, Novartis Pharmaceuticals, 5 56 Morris Avenue, Summit, NJ 07901, USA These authors contributed equally to this work Author for correspondence (e-mail: mlsiegal@stanford.edu) Accepted 10 July 2002 SUMMARY TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES Previous genetic studies indicated intersex (ix) functions only in females and t hat it acts near the end of the sex determination hierarchy to control somatic s exual differentiation in Drosophila melanogaster. We have cloned ix and characte rized its function genetically, molecularly and biochemically. The ix pre-mRNA i s not spliced, and ix mRNA is produced in both sexes. The ix gene encodes a 188 amino acid protein, which has a sequence similar to mammalian proteins thought t o function as transcriptional activators, and a Caenorhabditis elegans protein t hat is thought to function as a transcription factor. Bringing together the fact s that (1) the ix phenotype is female-specific and (2) functions at the end of t he sex determination hierarchy, yet (3) is expressed sex non-specifically and ap pears likely to encode a transcription factor with no known DNA-binding domain, leads to the inference that ix may require the female-specific protein product o f the doublesex (dsx) gene in order to function. Consistent with this inference, we find that for all sexually dimorphic cuticular structures examined, ix and d sx are dependent on each other to promote female differentiation. This dependent relationship also holds for the only known direct target of dsx, the Yolk prote in (Yp) genes. Using yeast 2-hybrid assay, immunoprecipitation of recombinant ta gged IX and DSX proteins from Drosophila S2 cell extracts, and gel shifts with t he tagged IX and DSXF proteins, we demonstrate that IX interacts with DSXF, but not DSXM. Taken together, the above findings strongly suggest that IX and DSXF f unction in a complex, in which IX acts as a transcriptional co-factor for the DN A-binding DSXF. Key words: Drosophila, doublesex, hermaphrodite, intersex, Sex determination INTRODUCTION TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES A single, multi-branched regulatory hierarchy controls all aspects of somatic se xual differentiation in D. melanogaster (Fig. 1) (reviewed by Cline and Meyer, 1 996; Marín and Baker, 1998). This hierarchy functions, via a cascade of alterna tive pre-mRNA splicing steps, to generate the sex-specific products of the doubl esex (dsx) and fruitless (fru) genes, which head two parallel branches. Here, we are concerned with the dsx branch of the sex hierarchy. Wild-type dsx function is necessary for all somatic sexual development outside the central nervous syst em (CNS) in males and females (Baker and Ridge, 1980), as well as some aspects o f sexual development in the CNS (Jallon et al., 1988; Taylor and Truman, 1992; V illella and Hall, 1996). The regulated splicing of the dsx pre-mRNA in females r esults in the production of a female-specific mRNA that encodes DSXF, whereas in males default splicing of the dsx pre-mRNA generates a male-specific mRNA which encodes DSXM. DSXM and DSXF are zinc-finger transcription factors with identica l DNA-binding domains, but different C termini (Burtis and Baker, 1989; Burtis e t al., 1991; Erdman and Burtis, 1993). The dsx gene is the last sex determinatio n regulatory gene in its branch of the hierarchy, as its proteins bind to, and r egulate the transcription of, the Yolk protein 1 (Yp1) gene (Burtis et al., 1991 ; Coschigano and Wensink, 1993). Functioning together with dsx in females are th e intersex (ix) (Baker and Ridge, 1980; Chase and Baker, 1995) and hermaphrodite (her) (Li and Baker, 1998a; Li and Baker, 1998b; Pultz and Baker, 1995; Pultz e t al., 1994) genes. View larger version (16K): [in this window] [in a new window] Fig. 1. The Drosophila somatic sex-determination hierarchy. The ratio of X ch romosomes to sets of autosomes determines the on/off state of the Sex-lethal (Sx l) gene. In females, where the X:A ratio is 1, active SXL protein is made and it s production is maintained via autoregulation. The presence of SXL causes splici ng of the transformer (tra) pre-mRNA such that active TRA protein is made. When TRA is present with the protein product of the transformer-2 (tra-2) gene, the p re-mRNA of the doublesex (dsx) gene is spliced into its female-specific form, wh ich encodes the DSXF protein. Similarly, the pre-mRNAs from the 5'-most promoter of the fruitless (fru) gene are spliced in a female-specific manner, and do not produce any detectable protein (three other promoters of fru produce transcript s that do not differ between the sexes). DSXF interacts with the products of the hermaphrodite (her) and intersex (ix) genes to activate female terminal differe ntiation and to repress male terminal differentiation. In males, where the X:A r atio is 0.5, no active SXL is made, so the tra pre-mRNA is spliced into its defa ult, male-specific form, which does not produce active TRA protein. Although it is present in males, TRA-2 cannot act without active TRA, so the dsx and fru pre -mRNAs are spliced into default, male-specific forms. The male-specific DSXM pro tein activates male terminal differentiation and represses female terminal diffe rentiation, interacting to some extent with HER. Although ix is expressed in mal es, like tra-2 it has no detectable function. The male-specific FRUM protein act ivates male courtship behavior. Arrows indicate positive regulation, bars indica te negative regulation and gray shading of gene names indicates that active prot eins are not produced in the given sex. Previous studies have provided some insights into the functional relationships o f the her and ix genes to dsx (Baker and Ridge, 1980; Pultz and Baker, 1995). Th e her gene is required maternally for the initial expression of the Sex-lethal ( Sxl) gene at the top of the sex determination hierarchy, and in addition is requ ired zygotically for female somatic sexual differentiation and some aspects of m ale somatic sexual differentiation (Li and Baker, 1998a; Li and Baker, 1998b; Pu ltz et al., 1994). Furthermore, epistasis analysis places the zygotic function o f the her gene in parallel to, or downstream of, the dsx gene (Li and Baker, 199 8b; Pultz and Baker, 1995). The ix gene is required for female, but not male, so matic sexual development (Baker and Ridge, 1980; Chase and Baker, 1995). Genetic epistasis studies indicate that ix also acts in parallel to, or downstream of, dsx in the sex-determination hierarchy (Baker and Ridge, 1980). Moreover, molecu lar data indicate that neither ix nor her is required for the sex-specific splic ing of dsx pre-mRNA (Nagoshi et al., 1988; Pultz and Baker, 1995). Therefore, th e genetic and molecular data suggest that ix, her and dsx function at, or near, the end of the hierarchy to regulate the terminal differentiation genes in femal es. Comparisons of the phenotypes of her, dsx double mutant flies with those of flie s that are mutant at just one of these genes showed that her and dsx act indepen dently to regulate some aspects of sexual differentiation and function interdepe ndently to control other aspects of sexual differentiation in females. Thus, the DSXF and HER proteins independently activate Yolk protein (Yp) gene expression in females. They also independently promote development of the vaginal teeth and anal plates in females (Li and Baker, 1998b). However, these proteins function interdependently to regulate female-specific differentiation of foreleg bristles and pigmentation of tergites 5 and 6 (Li and Baker, 1998b). The effect of her o n Yp gene expression is not through the fat body element (FBE), to which the DSX proteins bind (Burtis et al., 1991; Coschigano and Wensink, 1993), but rather t hrough Yp DNA sequences outside the FBE, consistent with the finding that these proteins control the Yp genes in an independent manner. That HER and DSXF act in dependently in regulating some aspects of sex and interdependently with respect to other aspects of sex could be due to different organizations of the regulator y elements of the genes being controlled in these tissues, or to differences bet ween the arrays of other factors regulating these genes together with HER and DS XF. There are also previous genetic data bearing on the relationship between dsx and ix. First, it has been reported that simultaneous heterozygosity for specific m utant alleles of ix and dsx in diplo-X flies results in a cold-sensitive interse xual phenotype (S. E. Erdman, PhD thesis, University of California at Davis, 199 4) (Erdman et al., 1996). As cold-sensitive nonallelic noncomplementation is fre quently indicative of protein-protein interactions (Hays et al., 1989; Stearns a nd Botstein, 1988), it has been suggested that there may be a physical interacti on between the IX and DSX proteins. Second, it has been shown that a dsxF transg ene promotes female differentiation in an XY individual that is otherwise wild t ype, but not in an XY individual lacking ix function (Waterbury et al., 1999). T hese findings led Waterbury et al. (Waterbury et al., 1999) to suggest that ix a nd dsx function interdependently and that IX is either constitutively expressed (and therefore present in males), or directly under the control of DSXF. To understand how the female-specific function of the ix gene is established and how ix regulates terminal differentiation in females, we have cloned the ix gen e. ix was localized to the cytological region 47F by complementation with defici encies and further localized to a 65-kb region by restriction fragment length po lymorphism (RFLP) mapping. A clone containing the ix gene was identified by its ability to rescue ix mutant phenotypes when introduced into flies by P-element-m ediated germline transformation. The ix protein has sequence similarity to prote ins proposed to act as transcriptional activators, but does not contain a known DNA-binding domain. Additionally, the ix pre-mRNA is not alternatively spliced, suggesting that the ix protein is present in both sexes and may interact with on e or more female-specific proteins to regulate female differentiation. As IX and DSXF are proposed to act at the bottom of the sex determination hierarchy, the possibility that these proteins cooperate to regulate female terminal differenti ation genes was investigated. Analysis of females mutant for ix, dsx, or both, d emonstrated that IX and DSXF function interdependently to activate Yp gene expre ssion and to regulate differentiation of vaginal teeth, anal plates, foreleg bri stles and sixth-tergite pigmentation. Therefore, unlike the DSXF and HER protein s, which cooperate to control some terminal differentiation genes and function i ndependently to regulate others, IX and DSXF function together to control somati c sex differentiation in all female structures analyzed. A possible mechanism fo r the interdependence of IX and DSXF is revealed by our demonstrations that IX i nteracts with DSXF, but not DSXM, in yeast 2-hybrid and co-immunoprecipitation a ssays, and that IX and DSXF form a DNA-binding complex, as assayed by gel shift. MATERIALS AND METHODS TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES Drosophila stocks Mutations and chromosomes not referenced are described elsewhere (Lindsley and Z imm, 1992). Crosses were carried out at 25°C unless another temperature is indi cated. Polytene chromosome analysis Deficiency breakpoints were analyzed in polytene larval salivary gland chromosom es dissected in 0.7% NaCl and stained with orcein (Ashburner, 1989). The deficie ncy stocks Df(2R)17 and Df(2R)27 (gift of R. Burgess) were crossed to wild-type flies and the Df/+ chromosomes were analyzed. The distal breakpoints for each de ficiency were determined. The insertion sites of the P elements #4412 and #13403 (Torok et al., 1993) were confirmed by in situ hybridization to polytene chromo somes following a standard protocol (Ashburner, 1989). Two changes to the proced ure were made: the chromosomes were dissected in 0.7% NaCl and the acetylation s tep was skipped. Southern analysis Genomic DNA was isolated, electrophoresed, transferred and probed using standard techniques (Sambrook et al., 1989). Restriction fragment length polymorphism (RFLP) mapping of intersex To localize ix by RFLP mapping, pairs of closely linked markers flanking the ix locus were employed. The P elements P[w+]4412, inserted at 47D, and P[w+]13403, inserted at 48A, were used (Torok et al., 1993). To generate recombination event s proximal or distal to the ix2 mutation, w/w; P[w+]4412 ix2/CyO females were cr ossed to w; P[w+]13403/CyO males, and the Cy+ female progeny (w/w; P[w+]4412 ix2 /P[w+]13403) were collected as virgins and crossed to w; Sp/CyO; Sb/TM2 males. T he male progeny of the latter cross were scored by eye color. Males with white e yes (no P element) and males with darker eye pigmentation (two P elements) were crossed to w/w; Sp/CyO; Sb/TM2 virgin females to establish stocks of the recombi nant chromosomes. To determine whether the recombinant chromosomes carried ix2, and thereby to determine the location of the crossover relative to the ix locus, males carrying the recombinant chromosomes were crossed to w/w; ix2/CyO virgin females. DNA samples isolated from P[w+]4412 ix2/CyO and P[w+]1340/CyO flies were digeste d with 24 restriction enzymes and probed with DNA fragments from the ix chromoso mal walk (Fig. 2B) to identify RFLPs between the two parental chromosomes. DNA s amples isolated from the fly stocks established for 22 recombinant chromosomes b alanced with the CyO chromosome were then analyzed using the restriction enzymes and DNA probes that identified RFLPs. This analysis indicated that six crossove r events mapped proximal and 16 crossovers mapped distal to the ix2 mutation. View larger version (34K): [in this window] [in a new window] Fig. 2. The cytological and physical localization of ix. (A) Deficiency mappi ng of ix. The boxes indicate the region of the chromosome deleted for each defic iency chromosome (reported breakpoints in parentheses after deficiency names). T he black boxes represent the deficiencies that fail to complement ix, and the wh ite boxes represent the deficiencies that complement the loss-of-function allele s of ix. (B) Chromosomal walk spanning ix. Cosmid and phage clones spanning the cytological region 47F are indicated by lines. The relevant deficiency breakpoin ts are indicated above the DNA walk, and the probes used for RFLP mapping are in dicated below the DNA clones. Map in A, reproduced (with permission) from Bridge s and Bridges (Bridges and Bridges, 1939). DNA polymorphisms between the parental chromosomes were identified and used to a nalyze the recombinant chromosomes. Southern analysis with four DNA fragments (R 16, 2G, 4C, P6.1) distributed across the 100 kb DNA walk (Fig. 2B) detected DNA polymorphisms between the P[w+]4412 ix2 and P[w+]13403 parental chromosomes. All six crossover events proximal to ix were also proximal to the R16 fragment, loc ated within 5 kb of the Df(2R)27 breakpoint, which indicated that all of the pro ximal recombination events isolated fail to further localize ix. Analysis of the distal crossovers was more informative. Using the 4C and P6.1 DN A clones as probes detected 3 recombination events proximal to these probes, and the remaining crossovers occurred distal to these fragments. Results with the 4 DXR DNA fragment as a probe demonstrated that all three of the crossovers proxim al to phage 4C are distal to this probe. Unfortunately, because of the uneven di stribution of recombination events, the location of ix cannot be ascertained by regression of crossover frequency on a physical map. However, the results of thi s RFLP analysis further localized ix to the region proximal to the 4C phage clon e and distal to the Df(2R)27 breakpoint, a 65 kb region. Northern analysis Wild-type (Canton-S) polyA+ RNA (5 µg per lane) from females and males was electrophoresed on a 1% agarose/1.85% formaldehyde gel, then transferred to a H ybond-N+ membrane and fixed by alkali treatment. For sizing bands detected by au toradiography, an RNA ladder (Life Technologies, Rockville, MD) was also run on the gel and visualized by staining with ethidium bromide. Hybridization with an antisense ix probe labeled with [-32P]UTP was carried out overnight in 5xSSPE, 5 xDenhardt’s solution, 0.4% SDS, 10 µg/ml salmon sperm DNA, 50% formamide at 60°C. Two washes in 2xSSC/0.1% SDS at room temperature for 15 minutes were f ollowed by one wash in 1xSSC/0.1% SDS at 65°C for 15 minutes, two washes in 0.1 xSSC/0.1% SDS at 65°C for 10 minutes, two washes in 0.1xSSC/0.1% SDS at 70°C f or 10 minutes, two washes in 0.1xSSC/0.1% SDS at 78°C for 10 minutes, and two w ashes in 0.1xSSC/0.1% SDS at 85°C for 10 minutes. The blot was then exposed to film. For probe-making, the ix cDNA was cloned into the HincII and EcoRI sites o f pBluescript KS II + (Stratagene, La Jolla, CA) as a MscI-EcoRI fragment. The p lasmid was linearized by digestion with ClaI, then transcribed by T7 RNA polymer ase in the presence of [-32P]UTP. As a loading control, the same blot was subsequently hybridized with a probe fro m the ninaE gene, which encodes the major rhodopsin, RH1 (O’Tousa et al., 1985) . The ninaE gene was chosen as a control because the transcript is not expressed sex-specifically (data not shown). The rp49 gene (O’Connell and Rosbash, 1984) , typically used as a loading control, was found to be expressed at higher level s in females than in males (data not shown) and therefore was determined not to be a good loading control for comparing the two sexes. The ninaE probe was label ed with [-32P]dCTP by extension of random hexamers, using as a template a PCR-am plified region of the gene from the beginning of exon 2 through the beginning of exon 5 (nucleotide positions 365 through 1716 in GenBank Accession Number K0231 5). Hybridization conditions were as above for the ix probe. Two washes in 2xSSC /0.1% SDS at room temperature for 15 minutes were followed by one wash in 1xSSC/ 0.1% SDS at 42°C for 15 minutes, two washes in 0.1xSSC/0.1% SDS at 68°C for 15 minutes, and two washes in 0.1xSSC/0.1% SDS at 75°C for 15 minutes. Relative i ntensities of male and female signals for the ix hybridization and the ninaE hyb ridization were determined by analyzing scanned autoradiographs with NIH Image 1 .62 software. P-element-mediated germline transformation To determine which one of the genes in the region to which ix had been localized was ix, two genomic rescue constructs were made and tested for their ability to rescue the ix phenotype. The 2GB construct was made by subcloning the 5.8-kb Ba mHI-EcoRI genomic fragment from phage 2G into the CaSpeR4 vector (Pirrotta, 1988 ). The 1GS construct was made by subcloning the 12-kb SalI fragment from phage 1 G into the XhoI site of the CaSpeR4 vector. A knockout construct for each gene present in the 2GB construct, designated R, G and H, was generated to test for the inability to rescue the ix phenotype. The knockout construct, 3GBR, which deletes the R gene after amino acid (aa) 16, was derived from the 2GB construct by the following procedure. The 2GB DNA was dige sted with SpeI and EcoRI, the ends were filled in with the Klenow fragment of DN A polymerase I (New England Biolabs, Beverly, MA), and the 9.7 kb SpeI-EcoRI CaS peR4 vector + genomic DNA fragment was isolated. In a separate reaction the 2GB plasmid was digested with SpeI, the ends were filled in with Klenow, and the 1.7 -kb SpeI genomic DNA fragment was isolated. The 1.7-kb SpeI blunt-ended DNA frag ment was ligated to the 9.7-kb SpeI-EcoRI blunt-ended DNA fragment. To identify the desired construct, the DNA from candidate clones was digested with PstI to d etermine the orientation of the 1.7 kb SpeI fragment and to confirm the presence of the 0.7 kb deletion. The knockout constructs for the G and H genes, 3GBG* an d 3GBH* respectively, were derived from the 3GB construct, which contains a 1.0 kb deletion that removes the adjacent tRNA:SeC and trypsin iota genes by the fol lowing procedure. The 3GB construct is a derivative of the 2GB construct. The 2G B DNA was digested with BglII and EcoRI, the ends were filled in with Klenow, an d then the DNA was ligated to itself generating a 1.0 kb deletion. For the 3GBG* construct, a stop codon was inserted at amino acid 91 by digesting the 3GB plas mid with SstII, recessing the ends with T4 DNA polymerase (New England Biolabs, Beverly, MA), and ligating a 12 bp linker, NheI* (New England Biolabs, Beverly, MA), containing an NheI site and stop codons in all three reading frames, to the blunt-ended 3GB DNA. Candidate clones were screened for the presence of the uni que NheI site and the absence of the unique SstII site. The 3GBH* construct was made using the same steps as those used to make the 3GBG* construct, except the unique SfiI site was used instead of the SstII site and the stop codon was inser ted at aa 44. Both 3GBG* and 3GBH* knockout constructs were further verified by DNA sequencing using the primers: G*1 (5'-CTCGCGGACAACTTAAAGAG) and H*1 (5'-GACA AGTTTTACGTGGAC). Heat-shock-inducible cDNA (hscDNA) constructs were made to test rescue of the ix phenotype. The G and H cDNAs were subcloned into the HpaI and NotI sites of the CaSpeRhs vector. cDNA H was inserted as a PvuII-NotI fragment, and cDNA G2 was inserted as a HincII-NotI fragment into the same vector. The 2GB, 1GS, and hscDNA constructs (0.3 µg/µl) were injected separa tely into w1118 embryos with the transposase source 2-3 (0.1 µg/µl) (Laski et al., 1986), following standard techniques (Rubin and Spradling, 1982; Spradling and Rubin, 1982). The knockout constructs were injected at the concent ration 0.4 µg/µl with the transposase source 2-3 (0.1 µg/&micr o;l) following the same method. G0 adults were crossed to w1118; Sp/CyO; Sb/TM2 flies of the opposite sex to identify transformants. All F1 progeny with pigment ed eyes were crossed to w1118; Sp/CyO; Sb/TM2 flies of the opposite sex to deter mine into which chromosome the construct inserted. The transgenes inserted into either the X or third chromosome were tested for rescue of the ix2 mutation. Lar vae carrying the hscDNA constructs were grown at 29°C continuously or heat shoc ked at 37°C for 1 hour each day during larval growth to assay rescue of the ix2 mutation. DNA sequencing The genomic sequence of gene G was determined by sequencing the R construct geno mic DNA from gene H to gene R on both strands by cycle sequencing using dye term ination reactions (Applied Biosystems, Foster City, CA). The primers used in the sequencing reactions were: G#1, 5'-GAAAACAATTCGCGGCTGTTCAATATTTT; G#4, 5'-TGCGCGGCACTAATCAGAGTGTCGTGT; G#7, 5'-TTCACCCTGGAAATGTTGTCCAATTTTTCGGCCT; G#8, 5'-CAAGGACTACCCAATATTTCATATTGTTACATACATAAAAGT; G#S1, 5'-CTCGCGGACAACTTAAAGAG; G#S2, 5'-TCACACGCATGCACTTAAGTTAAG; R#S2, 5'-CTTCATTGCAGGTGGGTG; and 5'UTR#2, 5'-ATGAGATGACAGCTCTTTCCGGTCGGTTGACATTAGCTA. RNase protection assay Total RNA from wild-type (Oregon-R) females and males was isolated from 4- to 5- day-old adult flies using TRIzol reagent (Life Technologies, Rockville, MD) acco rding to the manufacturer’s instructions. mRNA was purified from total RNA by b inding of polyA+ RNA to dC10T30 oligonucleotides linked to polystyrene-latex bea ds (Qiagen, Valencia, CA). For probe-making, the 457 bp MscI-PstI genomic DNA fr agment containing the ix translation initiation codon was subcloned into the Hin cII and PstI sites of pBluescript KS II + (Stratagene, La Jolla, CA). The plasmi d was linearized by digestion with XhoI, then transcribed by T7 RNA polymerase i n the presence of [-32P]UTP, producing a uniformly labeled 527-bp antisense ix p robe. The full-length probe was excised from a 5% acrylamide (19:1 acrylamide:N, N'-methylenebisacrylamide)/8 M urea gel and eluted in 350 µl of 0.5 M ammo nium acetate/1 mM EDTA/0.2% SDS for 2 hours at 37°C. The RNase protection assay was performed using reagents supplied by Ambion (Austin, TX) according to the m anufacturer’s instructions. PolyA+ female and male RNA (1.8 µg) were each combined with 15 µl of the probe eluate. Two control tubes containing 50 µg of total yeast RNA and 15 µl of probe eluate were also prepared. Sample and probe were allowed to hybridize 16 hours at 42°C. The female and mal e fly RNA hybridization and one of the yeast control hybridization reactions wer e then digested with a 1:100 dilution of RNase mix (250 U/ml RNase A, 10,000 U/m l RNase T1); one yeast control hybridization was left undigested. The RNases wer e then inactivated and the nucleic acids precipitated and resuspended in 10 &mic ro;l of gel loading buffer. The protected fragments were resolved on a 5% acryla mide/8 M urea gel. Only 10% of the yeast control without RNase digestion was loa ded. X174 DNA, digested with HaeIII and labeled with [-32P]dATP by fill-in with T4 DNA polymerase, was also loaded as a size marker. After electrophoresing, the gel was dried on Whatman 3MM chromatography paper and autoradiographed. 5' RACE and RT-PCR PolyA+ RNA (200 ng per reaction) from w1118 females and males was reverse transc ribed using gene-specific primer ix4 (5'-TGCGCGGCACTAATCAGAGTGTCGTGT). The 5' RA CE system (Life Technologies, Rockville, MD) was used to amplify the 5'-end sequ ence of the ix transcript, by first adding an oligo-dC tail to the 3' end of the cDNA with terminal transferase, then performing PCR with gene-specific primer i x12 (5'-CGATGGCGAGGATTGCATTACCTGCATCAT) and an anchor primer complementary to th e oligo-dC, followed by nested PCR amplification with gene-specific primer ixL ( 5'-GGCATCATGTTCATGTTGGGATTCAT) and a second anchor primer. The PCR conditions we re 94°C for 1 minute; 35 cycles of 94°C for 1 minute, 55°C for 1 minute, 72° C for 2 minutes; then 72°C for 7 minutes. These amplification products were clo ned and sequenced. A corresponding RT-PCR experiment using the same PCR conditio ns was performed on the same first-strand cDNA reactions (without dC-tailing) us ing a gene-specific primer, 5'UTR3 (5'-AATGCTAAATGAAACATTACACATCGTTTTTTATTTGGGA) , instead of the RACE anchor primers, for the two nested amplification reactions . RT-PCR products appearing to be splice variants because of their smaller size than predicted from genomic sequence, were cloned and sequenced. 3' RACE Wild-type (Canton-S) total RNA (5 µg per reaction) from females and males was reverse transcribed using an oligo-dT-containing adapter primer (Life Techno logies, Rockville, MD). This first-strand cDNA was then subjected to PCR amplifi cation: 94°C for 1 minute; 30 cycles of 94°C for 1 minute, 56°C for 1 minute, 72°C for 1 minute; then 72°C for 7 minutes, using gene-specific primer ix943U (5'-TTAAAGAGGGACACGGGTGC) and a universal amplification primer with sequence ma tching the non-oligo-dT segment of the adapter primer (Life Technologies, Rockvi lle, MD). A second, nested PCR amplification reaction was performed using gene-s pecific primer ix1032U (5'-CTTGAAGACGGCGATGCAGT) and the same universal amplific ation primer. These amplifications yielded single products of approximately 350 bp for both female and male RNA. The amplification products were cloned and sequ enced. CPRG assay The lacZ activities were measured according to a previously published protocol ( Coschigano and Wensink, 1993) incorporating published modifications (Li and Bake r, 1998b). Statistical analysis The Yp data were analyzed using a two-factor analysis variance (ANOVA), with ix genotype and transgene presence/absence as fixed main effects for the pML-58 exp eriments and with ix genotype and dsx genotype as fixed main effects for the pCR 1 experiments. To detect interactions between ix and dsx, the pCR1 experiment da ta were log-transformed before ANOVA, as multiplicative effects in the raw data become additive in the transformed data. Bristle counts for vaginal teeth, LTRB and sixth sternite were found to have heterogeneous variances among genotype cla sses, so the non-parametric Mann-Whitney U test (1-tailed) was used to detect di fferences between the classes. A G-test with the Yates correction was used to an alyze the dorsolateral anal plate data. For sixth-tergite pigmentation, arcsin-t ransformed data were analyzed by one-tailed Student’s t-test. Yeast two-hybrid assays The Matchmaker Gal4 two-hybrid system (BD Biosciences Clontech, Palo Alto, CA) w as used according to the manufacturer’s protocols. Briefly, full-length IX-, DS XF- and DSXM-coding sequences were cloned into the pAD and pBK vectors, which we re co-transformed in pairs into the AH109 yeast strain and plated on -Ade, -His, -Leu and -Trp restrictive medium. Transformants that grew on this restrictive m edium were further assayed for positive interactions by a colony-lift ß-ga lactosidase assay. Cell culture and co-immunoprecipitation IX, DSXF and DSXM coding sequences were cloned in frame into the pAc5.1/V5-HisB or pMT5.1/V5-His (Invitrogen Corporation, Carlsbad, CA) vectors. To generate AU1 -tagged constructs, the V5 epitope and polyhistidine regions of the V5-tagged co nstructs were replaced by digestion with BstBI and PmeI and ligation with an oli gonucleotide dimer (5'-GTT/CGAAGACACCTATCGCTATATACGTA/CCGGTCA) containing an in- frame AU1 epitope (Covance, Princeton, NJ). Drosophila S2 cells were cultured in Schneider’s Drosophila medium (Gibco) in 10% FCS. Transfections were performed using Effectene reagent (Qiagen, Valencia, CA) according to the manufacturer’s protocol and as described elsewhere (Mosher and Crews, 1999). Briefly, cells we re washed in PBS pH 7.4 and plated in media at a density of 5-7x105 cells/ml in a six-well plate (1.6 ml/well). Plasmid (2 µg) and Effectene mixture was a dded and cells were grown for 24 hours prior to induction with 500 mM copper sul fate for an additional 24 hours. Cells were washed in PBS and nuclear extracts (200 µl/well) were prepared as described elsewhere (Huang and Prystowsky, 1996). Extracts were normalized to equal protein concentrations and 100 µl samples were incubated with 2 &mi cro;l monoclonal anti-AU1 antibody (Covance, Princeton, NJ) for 1 hour at room t emperature. Bovine serum albumin was added to 2% final volume and lysates were i ncubated with Protein G Sepharose beads (Amersham Pharmacia Biotech, Piscataway, NJ) for an additional 2 hours at room temperature. Beads were pelleted, washed and transferred to SDS loading buffer. Proteins were resolved on a 12% SDS gel a nd probed via western blot using rabbit polyclonal anti-V5 antisera (Medical & B iological Laboratories, Nagoya, Japan) according to standard protocols. Electrophoretic-mobility shift assay Drosophila S2 cells were cultured and transfected as described above. Nuclear ex tracts (200 µl/well) were prepared as described above. Probe fragments wer e made by 32P end-labeling the 185 bp ClaI-BglII FBE fragment of the Yp promoter region described previously (Burtis et al., 1991). Extracts (10 µl) were incubated in binding buffer [4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 5 0 mM NaCl, 10 mM Tris-HCl pH 7.5, 0.05 mg/ml poly-dI-dC, protease inhibtor cockt ail (Roche Applied Science, Indianapolis, IN, catalog number 1697498)] and 2 &mi cro;l (50-100K cpm) probe was added for 20 minutes at room temperature. Monoclon al anti-V5 (Invitrogen Corporation, Carlsbad, CA) or anti-AU1 (Covance, Princeto n, NJ) antibody was added in samples for super-shift where indicated. Proteins w ere resolved via native PAGE (4% acrylamide, 5% glycerol, 0.5xTBE) and complexes were visualized via autoradiography. RESULTS TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES Cytological and physical localization of intersex Complementation tests with deficiencies and loss-of-function alleles of ix local ized ix to the cytological region 47E-47F11-18 (Chase and Baker, 1995). In addit ion to the previously characterized deficiencies, two new deficiencies were test ed (Fig. 2A). Df(2R)17 fails to complement ix and Df(2R)27 complements ix. These complementation results place ix in the cytological region 47F between the Df(2 R)27 breakpoint at 47F1 and the Df(2R)ixi3 breakpoint at 47F11-18. However, one complementation test with Df(2R)ix87i3 gave a result that was not consistent wit h that localization of ix. Df(2R)ix87i3 complemented a temperature-sensitive all ele, ix4, at the nonpermissive temperature, although it failed to complement all other ix alleles tested (Chase and Baker, 1995). After ix was molecularly ident ified, it was determined that the Df(2R)ix87i3 chromosome contains a more comple x rearrangement. In addition to the deletion of 47D-47F11-18, at least 6 kb of D NA containing ix (which is located approximately 70 kb from the 47F11-18 deletio n breakpoint) was transposed to cytological position 50 on chromosome arm 2R. Th us, the complementation of the temperature-sensitive allele of ix by this defici ency chromosome was due to the transposed ix locus. A chromosomal walk was compl eted through the 47F interval and the relevant deficiency breakpoints were mappe d to the DNA in the walk (Fig. 2B). The region between the Df(2R)27 and Df(2R)ix 87i3 breakpoints, within which ix is located, is 100 kb. To localize ix in this 100 kb region, restriction fragment length polymorphism (RFLP) mapping was carri ed out (see Materials and Methods). This narrowed the region of interest to 65 k b. Identification and characterization of intersex candidate genes To locate candidate genes in the 65 kb region identified by the RFLP mapping, ph age clones covering the entire region were used as probes to isolate cDNAs (B. C . W., C. M. G.-E., E. Williams and M. L. Goldberg, unpublished). Five cDNA class es were identified (Fig. 3A). However, for most of the classes only one cDNA was isolated, raising the possibility that other genes may reside in this region an d were not detected. Analysis of the Drosophila genome sequence (Adams et al., 2 000) indicated that four additional transcripts (CT25954, CT25948, CT32444 and C T25938) are predicted in this region. Some or all of these predicted transcripts represent potential additional candidate genes. In addition, a tRNA:SeC gene an d a cluster of trypsin genes (Wang et al., 1999) were previously mapped to the i x region. View larger version (13K): [in this window] [in a new window] Fig. 3. The ix region defined by RFLP mapping and P-element-mediated germline transformation. (A) 65 kb ix region. cDNAs and known genes are indicated below the phage and cosmid clones in the ix region, and the genomic rescue constructs 2GB and 1GS are shown below the cDNAs. (B) Restriction-site map of the ix region defined by the 2GB genomic rescue construct. Transcripts included in the 2GB co nstruct are indicated as arrows. The extents of germline transformation construc ts are shown below the map, with rescue results indicated. Triangles indicate th e positions of inserted stop codons. B, BamHI; P, PstI; R, EcoRI; S, SalI. P-element-mediated germline transformation experiments were undertaken to determ ine whether one of the genes identified in the 65 kb region was ix. The genomic rescue construct 2GB, which contains a 6 kb segment from the proximal part of th e 65 kb ix walk, encompassing three genes of unknown function, as well as the tR NA:SeC and trypsin iota genes, was tested first for rescue of the ix phenotype ( Fig. 3B). Two 2GB lines with insertions on the third chromosome were tested for rescue of the ix2 mutation, and one line with the transgene inserted on the seco nd chromosome was recombined onto the Df(2R)enB chromosome and then tested for r escue of the ix2/Df(2R)enB phenotype. The somatic phenotype of the ix mutant fem ales carrying the transgenes ranged from fully rescued (normal female developmen t) to no rescue of the intersexual phenotype, depending on the lines tested and whether one or two copies of the transgenes were present. Because the ix phenoty pe was rescued for some of the ix mutant females, ix is one of the genes contain ed within the 2GB construct (Fig. 3B). The variable rescue of the ix phenotype s uggested that this 6 kb genomic construct containing the ix gene was sensitive t o position effect. Transformants with an overlapping construct 1GB were tested, and this construct also rescued the ix2/Df(2R)enB phenotype (Fig. 3B). The regio n of overlap between these two constructs is 4.5 kb and contained the three cand idate genes R (CG12384), G (CG13201) and H (CG12352), but not the tRNA:SeC and t rypsin iota genes. To ascertain whether the DNA sequence of these three genes might indicate which is most likely ix, a cDNA representing each gene was sequenced. The amino acid s equence of each predicted protein was compared with sequences in the GenBank CDS translation, PDB, SwissProt, PIR and PRF databases using the PSI Blast program. Gene R encodes a protein that is 43% identical and 52% similar to the human dea th associated protein 1 (DAP1) (Deiss et al., 1995). The predicted H protein is 19% identical and 37% similar to the Saccharomyces cerevisiae ARD-1 (arrest-defe ctive-1) protein (Whiteway and Szostak, 1985), and 22% identical and 43% similar to a N-acetyltransferase ARD-1 human homolog. Gene G encodes a novel protein. T he sequence similarities of the candidate genes did not indicate that one gene w as a better ix candidate than the others. P-element-mediated germline transformation experiments were carried out with add itional genomic constructs, to determine which candidate gene is ix. The approac h taken was to knock out each candidate gene individually, while leaving the oth er two genes intact and to assay each of these derivatives of 2GB for the inabil ity to rescue the ix phenotype. The 3GBR construct deletes all but the first 16 amino acids of the R protein, the 3GBG* construct introduces a stop codon in the middle of the G protein at amino acid position 91, and the 3GBH* construct intr oduces a stop at amino acid position 44 of the H protein. For the 3GBR construct , 21 lines were isolated with 13 insertions on the third chromosome, for the 3GB H* construct 43 lines were isolated with 18 insertions on the third chromosome, and for the 3GBG* construct 21 lines were isolated with 13 insertions on the thi rd chromosome. The transgenic lines with insertions on the third chromosome were tested for rescue of the ix2 phenotype. All 13 of the 3GBG* lines failed to res cue the ix phenotype (Fig. 3B, Fig. 4). For comparison, only one out of the 13 3 GBR lines and 1 of the 10 3GBH* lines tested failed to rescue the ix phenotype. This analysis of the knockout transgenes indicated that candidate G was ix. View larger version (130K): [in this window] [in a new window] Fig. 4. Cuticle preps of wild-type and ix-mutant females. (A) Abdomen of wild -type female. (B) Abdomen of ix2/ix2 female. (C) Abdomen of ix2/ix2 female carry ing one copy of the 3GBG* transgene. (D) Abdomen of ix2/ix2 mutant female carryi ng two copies of the heat-shock-inducible G cDNA transgene. To establish unequivocally that candidate G was ix, a heat-shock-inducible cDNA construct for gene G was tested for rescue of the ix phenotype. One of the five lines tested for the hscDNA G construct partially rescued the ix2 phenotype when the larvae were grown continuously at 29°C (Fig. 4). Females carrying two copi es of the transgene were rescued for the somatic defects but were not fertile, a nd females with one copy of the transgene were partially rescued. The results of experiments with the 3GBG* and hscDNA G transgenes showed that gene G is ix. intersex sequence analysis The ix gene encodes a protein of 188 amino acids (Fig. 5A,B). Analysis of the Ge nBank, EMBL and DDBJ EST databases using the Gapped Blast program identified mam malian ESTs and predicted proteins with significant similarity to the ix protein . The functions of the genes represented by these ESTs are unknown. From amino a cids 15 to the C terminus of IX, the longest EST, a mouse EST (AA388092), is 37% identical and 52% similar to the ix protein; this mouse EST does not show simil arity to the N-terminal 15 amino acids of IX. This similarity is highest in a 35 amino acid region of these proteins from amino acid 95 to amino acid 129. The s equence in the 35 amino acid region is 55% identical and 74% similar between the ix protein and either the mouse EST or a very similar human EST (U46237) (Fig. 5D). The stop codon introduced in the 3GBG* rescue construct is located just bef ore this region. If the truncated G* protein is stable, the 35 amino acid region or a region after it must be required for ix function. Additionally, from amino acid 20 to the C terminus of IX, two predicted human proteins (XP_046121 and DK FZp434H247.1) are 35% identical and 50% similar to IX. View larger version (69K): [in this window] [in a new window] Fig. 5. ix DNA sequence and predicted protein product. (A) DNA and protein se quences. The ix DNA sequence (GenBank Accession Number, AF491289) is shown with the predicted protein sequence in single-letter code below the corresponding nuc leotides. 5' RACE experiments defined the start of the 5' UTR (underlined), and 3' RACE experiments determined the 3' end of the mRNA (position at which polyade nylation begins underlined). The putative upstream exon suggested by results of RT-PCR experiments is indicated in bold. (B) Schematic of the predicted ix prote in. The asterisk indicates the stop codon inserted in the 3GBG* knockout constru ct. The gray and black boxes represent regions of the ix protein with sequence s imilarity to known proteins and ESTs. (C) Sequence alignment of the N-terminal r egion of the ix protein (gray in B) with the mammalian SYT and C. elegans sur-2 proteins. The consensus sequence is shown below. (D) Sequence alignment of a reg ion of the ix protein (black in B) with the predicted proteins of human and mous e EST sequences. The consensus sequence is shown below. Comparison with sequences in the GenBank CDS translation, PDB, SwissProt, PIR an d PRF databases using the PSI Blast program with aa position 3 to 47 in the N-te rminal region of the ix protein revealed sequence similarity to the human synovi al sarcoma translocation (SYT) protein (Clark et al., 1994), mouse SYT protein ( de Bruijn et al., 1996) and the C. elegans suppressor of ras protein (SUR-2) (Si ngh and Han, 1995). In the 44 amino acid region of similarity, the ix protein is 45% identical and 51% similar to the human SYT protein, 50% identical and 52% s imilar to the mouse SYT protein, and 42% identical and 47% similar to SUR-2 (Fig . 5C). The sur-2 gene was identified as a suppressor of the ras multivulva phenotype (S ingh and Han, 1995). Genetic epistasis analysis placed sur-2 at the same positio n as transcription factors in the vulval signal transduction pathway (Singh and Han, 1995), suggesting that the sur-2 protein may function as a transcription fa ctor. The SYT protein is proposed to act as a transcriptional activator (Brett et al., 1997). In vitro analysis of SYT indicates that the 155 amino acid region of SYT with the highest transcriptional activation function contains the 44 amino acid sequence with similarity to ix (Brett et al., 1997). The sequence similarity of the IX protein to a region of the SYT protein that is capable of activating tra nscription raises the possibility that ix may function as a transcriptional acti vator. Regulation of intersex by the sex-determination hierarchy Because the ix phenotype is female specific and some genes in the somatic sex-de termination hierarchy are regulated at the level of splicing, it was conceivable that the ix pre-mRNA would be sex-specifically spliced. However, no introns wer e identified by comparing the genomic sequence with the ix cDNA sequence, and No rthern analysis did not detect sex-specific transcripts (Fig. 6A). In both males and females, a single hybridizing RNA species of approximately 750 bp was obser ved, consistent with the expected transcript size as determined by 5' and 3' RAC E, which is 734-766 bases (start position 612-626, end position 1332, tail 28-46 bases, Fig. 5A). The start position determined by 5' RACE is variable in both m ales and females but does not show a sex-specific difference. The relative signa l intensity in males and females for the ix northern hybridization was normalize d by the relative signal intensity in males and females for hybridization to nin aE. The ix transcript is 8.7 times as abundant in wild-type females as in wild-t ype males. Preliminary data (not shown) from ix mutant germline clones in female s, and from RNA analysis of females lacking a germline, suggest that the differe nce in transcript levels between females and males may be due to high ix express ion in ovaries. The northern hybridization, cDNA analysis and 5' RACE results su ggest that the ix transcript is not sex specific and is not spliced. View larger version (35K): [in this window] [in a new window] Fig. 6. Regulation of ix transcription. (A) Northern hybridization of female and male polyA+ RNA with probes from ix and ninaE. The arrow points to the posit ion to which a 750 nucleotide molecule would migrate, as determined by a size ma rker run on the gel that was blotted (not shown). The relative abundance of fema le and male ix transcripts is given at the bottom, normalized to the amounts of ninaE transcript in each lane. (B) Scheme for RNase protection assay. A restrict ion map of the genomic region surrounding the putative ix translation start site (indicated by arrow labeled ‘Met...’) is shown, with the locations indicated of the putative transcription start site (as identified by 5' RACE, labeled ‘RA CE start’), of the polyadenylation signal sequence (as identified by 3' RACE, l abeled ‘polyA’), and of the potential intron from a transcript originating 5' to the RACE start (as identified by RT-PCR analysis, labeled ‘RT-PCR intron’). Aligned below the map is the full-length, 527 nucleotide probe used for the ass ay, which stretches from the MscI site to the 5'-most PstI site, and includes se quences from the T7-promoter-containing vector used to produce it (dashed region of arrow). Below the probe are the predicted protected fragments corresponding to the different potential ix transcripts. An unspliced transcript originating 5 ' to the MscI site would protect a probe fragment of 457 nucleotides, whereas an unspliced transcript originating at the site identified by 5' RACE would protec t a probe fragment of 203 nucleotides. If a transcript originating 5' to the Msc I site were spliced at the donor and acceptor sites identified by RT-PCR, this p rocessed transcript would protect two probe fragments, 46 nucleotides and 132 nu cleotides in length. (C) RNase protection assay. Female and male polyA+ RNA samp les were each hybridized in solution with the probe shown in B, then digested wi th RNase and electrophoresed. Yeast RNA controls were also performed, either wit h (‘Y+’) or without (‘Y–’) RNase. Size markers are in lanes marked ‘M’ and the sizes of marker bands are indicated at right. The arrow points to the position to which a 203 nucleotide molecule would migrate. However, sequence analysis of the genomic region just upstream of the transcript ion start site of the ix gene identified by 5' RACE revealed a potential exon an d intron. The putative exon would encode 33 amino acids and contain a consensus donor splice site (Fig. 5A). RT-PCR experiments, using a 5' PCR primer that begi ns upstream of and extends into the putative exon, detected products that were o f the size expected from the genomic DNA and smaller, apparently spliced, produc ts were sometimes observed (data not shown). The RT-PCR result raises the possib ilities that the transcription start determined by 5' RACE is not correct or tha t a transcript initiating from an upstream start site is also expressed but at a much lower level, and was not detected by northern analysis or in the cDNAs iso lated. To confirm the ix pre-mRNA was not sex-specifically processed, RNase protection assays of polyA+ RNA isolated from males and females were performed using a prob e that could distinguish between the spliced and unspliced products (Fig. 6B). R Nase protection assays depend on neither reverse transcription nor amplification of the RNA as RT-PCR does, and RNase protection assays are more sensitive than northern analysis and could detect a rare transcript. The major protected fragme nt is approximately 200 bp (Fig. 6C), as expected for an unspliced transcript th at begins at the site indicated by 5' RACE. Additionally, no qualitative differe nce between male and female protected fragments was observed. These results agre e with the northern data, cDNA analysis and 5' RACE results, and indicate the ix pre-mRNA is not spliced. Therefore, alternative processing of the ix transcript is not responsible for the female-specific ix phenotype, suggesting that ix fun ctions together with one or more female-specific proteins to achieve the sex-spe cificity of the ix phenotype. ix regulation of terminal differentiation As ix functions at approximately the same position in the sex determination hier archy as dsx, we carried out genetic experiments to ascertain whether ix coopera tes with, or functions independently of, dsx to control female sexual differenti ation. We examined how ix and dsx function relative to one another in controllin g Yp gene expression and the development of an array of sexually dimorphic cutic ular structures. We first focused on the role of ix in controlling Yp gene expression. Previous s tudies identified the Fat Body Enhancer (FBE) in the Yp1 and Yp2 intergenic regi on as necessary and sufficient for the sex-specific expression of both Yp1 and Y p2 (Garabedian et al., 1986). DSX regulates Yp gene expression through three DSX binding sites in the FBE (An and Wensink, 1995; Burtis et al., 1991; Coschigano and Wensink, 1993) and northern analysis suggests that ix+ was required for DSX F mediated activation of Yp1 transcription (Waterbury et al., 1999). To confirm that ix regulates Yp gene expression and to determine whether ix activates Yp ex pression through the same regulatory region as dsx, the expression of Yp reporte r gene constructs was assayed in wild-type and ix mutant females. Our analysis of the expression levels of the pML-58 Yp reporter construct (provi ded by M. Lossky and P. Wensink), which contains the FBE and 196 bp of the Yp1 a nd Yp2 intergenic region fused to the lacZ gene, indicates that this region is s ufficient for ix regulation of the Yp genes in females. Chromosomal females eith er homozygous or heterozygous for an ix mutation and either carrying or not carr ying an ix+ transgene were compared. Including the transgene in the analysis all ows definitive assignment of an effect on reporter expression to ix and not to a linked locus. A 1.9-3.5-fold reduction in lacZ activity from pML-58 reporter-co nstruct expression was observed comparing homozygous and heterozygous ix-mutant females (Fig. 7A, ANOVA genotype main effect P<0.0001). Therefore there is a sig nificant effect of the ix genotype on expression of the Yp reporter construct re gardless of the presence or absence of the ix transgene. Additionally, the effec t of the ix transgene on expression of the Yp gene reporter construct is to incr ease lacZ activity (ANOVA transgene main effect P<0.0001). There is no significa nt interaction between the ix genotype and the presence of the ix transgene (ANO VA interaction P=0.74), indicating that adding one wild-type copy of the ix gene , either at the ix locus or via the transgene, increases Yp reporter gene expres sion equivalently. As the ix-mutant females assayed are heteroallelic (ix2/ix3) and one copy of the ix transgene rescues the decreased Yp reporter construct exp ression observed in these ix-mutant females, the reduction in Yp gene expression is due to the ix mutation and not another mutation on the second chromosome. Th ese results indicate that the ix protein activates transcription of the Yp gene reporter construct in females through a region that contains the DSXF DNA-bindin g sites, raising the possibility that IX interacts with DSXF to regulate express ion of the Yp genes. View larger version (26K): [in this window] [in a new window] Fig. 7. ix and dsx act interdependently to activate Yp reporter expression in females. (A) Progeny from pML-58/pML-58; ix3/SM; ry/ry mothers crossed to w/Y; ix2/CyO; P[ix+ 9.5]/MKRS fathers. (B) Progeny from pCR1/pCR1; ix3/CyO; dsx pp/MK RS mothers crossed to w/Y; Df(2R)enB/CyO; dsx127/MKRS fathers. Mean lacZ activit y is plotted for each progeny genotype, in units of OD574/minute/mg fly, based o n the CPRG assay. Error bars are +1 s.e.m. Each genotype was assayed at least in triplicate. To investigate whether ix regulation of the Yp genes is dependent on dsx activit y, expression of the pCR1 Yp reporter construct (Lossky and Wensink, 1995), whic h contains the entire Yp1 and Yp2 intergenic region fused to a lacZ reporter gen e, was analyzed in ix, dsx and ix; dsx double mutant flies. The use of the full intergenic region, including the her responsive region (HRR) outside the FBE (Li and Baker, 1998b), increases the resolution of the analysis, as her upregulates Yp expression approximately fivefold, except when DSXM is present, thereby ampl ifying expression differences due to the presence or absence of DSXM activity. p CR1 expression was reduced in both ix mutant females (Fig. 7B, ANOVA ix genotype main effect P=0.0001) and dsx mutant females (ANOVA dsx genotype main effect P< 0.0001). If ix and dsx act independently to regulate Yp expression, then the com bined effect of the ix; dsx mutant would be the product of the individual mutant effects. Log-transforming the data makes multiplicative effects additive, so th e ixxdsx interaction term in the ANOVA is an indicator of the independence of th e effects of the two loci. The interaction between ix and dsx is highly signific ant (P<0.0001), indicating a strong dependent relationship between the two loci. In males, the ix genotype has no effect on the level of pCR1 expression (Fig. 7 B, P=0.4), but the dsx genotype has a significant effect on pCR1 expression (P<0 .0001). The interaction between ix and dsx is not significant (P=0.71). These re sults indicate that ix does not function in males to regulate Yp gene expression . Therefore, the ix protein only functions in females and cooperates with DSXF t o activate Yp gene expression. In addition to regulating Yp expression, DSXF controls the development of sexual ly dimorphic cuticular structures (Baker and Ridge, 1980; Li and Baker, 1998b). Because the ix phenotype is indistinguishable from the dsx female phenotype, IX may also interact with DSXF to regulate these aspects of female differentiation. However, her, another gene with a phenotype similar to ix and dsx, cooperates w ith dsx to control female differentiation of foreleg bristles and tergites 5 and 6, but functions independently of dsx to regulate development of vaginal teeth and anal plates in females (Li and Baker, 1998b). If ix acts independently of ds x to regulate some aspect of terminal sexual differentiation, then in ix; dsx mu tant females that aspect of sexual differentiation would be masculinized compare d with the individual mutants. However, if the genes function together then the phenotype of ix; dsx double mutants would be the same as that of the single muta nts. To test these possibilities, the phenotypes of five sexually dimorphic cuti cular structures in ix, dsx and ix; dsx mutant flies were assayed. The first cuticular phenotype examined was the number of vaginal teeth in female s. There are on average 26.6 vaginal teeth on ix/+; dsx/+ females (Table 1, row 1) and 0 vaginal teeth on ix/+; dsx/+ males (Table 1, row 5). The intersexual ix and dsx single mutant females had on average 9.7 vaginal teeth and 6.0 vaginal teeth, respectively, significantly fewer than wild-type females [Table 1, compar e rows 1 and 2 (P<0.0001), and rows 1 and 3 (P<0.0001)]. The ix; dsx mutant fema les formed on average 6.45 vaginal teeth, indicating that loss of wild type ix f unction does not masculinize dsx mutant females (Table 1, rows 3 and 4, P=0.77). This result indicates that dsx is dependent on wild-type ix activity for vagina l teeth development in females. Elimination of wild-type dsx function appears to weakly masculinize the ix mutant females (Table 1, rows 2 and 4, P=0.032). Howe ver, this effect may be due to the fact that the EMS-induced ix3 allele is a str ong loss-of-function allele but is not completely null (Chase and Baker, 1995). The nucleotide sequence of ix3 is consistent with this inference, in that the on ly difference between ix3 and the ix+ allele of its progenitor stock is a T to A substitution in nucleotide 1221, which results in a Ser to Arg amino acid subst itution (data not shown). We thus conclude that ix and dsx act interdependently to regulate differentiation of vaginal teeth in females. View this table: [in this window] [in a new window] Table 1. The next sexually dimorphic structure analyzed was the anal plates. Females have one dorsal and one ventral anal plate, and males have two lateral anal plates. Intersexual flies have a pair of dorsolateral plates that are often fused at the dorsoanterior side. When collecting the data for all genotypes, the wild-type f emale dorsal anal plate was considered fused. All ix/+; dsx/+ females had fused dorsal anal plates (DLAP) compared with 65% of the dsx mutant females [Table 1, compare rows 1 and 3 (P=0.0073)] and 90% of the ix mutant females [Table 1, comp are rows 1 and 3 (P=0.46)] that had fused DLAP. Although 90% of the ix mutant fe males had fused DLAP, these anal plates appeared intersexual because the two ana l plates were not completely fused into one anal plate. Thus the absence of stat istical significance should not be taken as evidence against a sex-transforming effect of ix on the anal plates of females. Similar to the single mutant phenoty pes, 85% of the ix; dsx mutants had fused DLAP [Table 1, compare rows 3 and 4 (P =0.27) and rows 2 and 4 (P=1)], indicating that the ix; dsx double mutant phenot ype is not stronger than the single mutant phenotypes. Therefore, ix and dsx do not act independently in the anal-plate precursor cells to control female-specif ic differentiation of anal plates. Two other sexually dimorphic cuticular phenotypes analyzed were the extent of pi gmentation of the sixth tergite and the development of the last transverse row o f bristles (LTRB) on the basitarsus, which form the sex combs in males. With res pect to pigmentation of tergite 6, the ix/+; dsx/+ females had on average 53% pi gmentation (Table 1, row 1) and the ix/+; dsx/+ males had 97% pigmentation (Tabl e 1, row 5). The loss of wild-type ix or dsx activity increased pigmentation of the sixth tergite significantly, to 92% and 96%, respectively [Table 1, compare rows 1 and 2 (P<0.0001), and rows 1 and 3 (P<0.0001)]. Similarly, in the ix; dsx double mutant females, the extent of pigmentation was 95% [Table 1, compare row s 3 and 4 (P=0.65), and rows 2 and 4 (P=0.045)]. Therefore, the double mutant ph enotype is comparable with the single mutant phenotypes. The results for the ana lysis of differentiation of LTRB were the same as for pigmentation of tergite 6. In ix/+; dsx/+ females, an average of 5.28 bristles formed compared with 10.6 b ristles on ix/+; dsx/+ males (Table 1, rows 1 and 5). The number of bristles inc reased significantly, to 6.8 in ix mutant females and 7.75 in dsx mutant females [Table 1, compare rows 1 and 2 (P<0.0001), and rows 1 and 3 (P<0.0001)], and th e ix; dsx double mutant females had 7.25 bristles, similar to the single mutants [Table 1, compare rows 3 and 4 (P=1.0) and rows 2 and 4 (P=0.004)]. For both si xth-tergite pigmentation and LTRB differentiation, the ix; dsx mutant females we re weakly masculinized compared with the ix mutant females but not the dsx mutan t females. Again, this observation is presumably due to the fact that the ix3 al lele is not completely null and residual ix activity is eliminated in the double mutant by loss of dsx function. These results indicate that for female-specific development of the LTRB and pigmentation of the sixth tergite, ix and dsx funct ion cooperatively. The last cuticular phenotype examined was the number of bristles formed on the s ixth sternite. Females have an average of 20.85 bristles (Table 1, row 1) and ma les have an average of 0.30 bristles (Table 1, row 5) on the sixth sternite. Pre vious analysis indicated that bristles form on the sixth sternite of females ind ependent of the activity of dsx and her (Li and Baker, 1998b). A comparison of t he phenotypes of ix mutant females and ix/+; dsx/+ females demonstrates that the development of these bristles is also independent of ix function [Table 1, comp are rows 1 and 2 (P=0.73)]. In this analysis the dsx mutant females had a slight reduction in the number bristles, from 20.85 to 19.50 [Table 1, compare rows 1 and 3 (P=0.0045)]. However, this weak effect of the dsx genotype was not observe d in previous studies and may represent differences in the genetic background of these flies. The analysis of these sexually dimorphic cuticular structures in males indicated that ix does not function in males. Unlike the dsx mutant males, ix mutant male s did not develop vaginal teeth nor do they have fused dorsal lateral anal plate s (Table 1, rows 6 and 7). The extent of pigmentation of the sixth tergite and d ifferentiation of the LTRB on the basitarsus were also unaffected (Table 1, rows 5 and 6). The wild-type activity of both dsx and her is required in males to pr event bristle formation on the sixth sternite (Li and Baker, 1998b). However, lo ss of ix function did not increase bristle formation on S6 [Table 1, compare row s 5 and 6 (P=0.18)]. These results confirm previous results that ix only functio ns in females (Chase and Baker, 1995). In all cases, we examined in which ix and dsx regulate female differentiation of cuticular structures – formation of vaginal teeth, development of the dorsal anal plate, development of the LTRB and pigmentation of the sixth tergite ?C the phenotype of the ix; dsx double mutant females was not masculinized compar ed with the ix and dsx single mutant phenotypes. Although the analysis of vagina l teeth differentiation, pigmentation of the sixth tergite, and formation of LTR B revealed that elimination of wild type dsx activity weakly masculinized ix mut ant females, this effect probably represents the elimination of residual ix acti vity because the ix alleles may not be complete loss of function alleles (Chase and Baker, 1995). Therefore, the results of the phenotypic analysis of sexually dimorphic cuticular structures and the Yp gene reporter constructs indicate that ix and dsx act interdependently to regulate all aspects of female terminal diff erentiation. Physical interaction of IX and DSXF Given the sex-specific effect of ix mutants, and the dependence of DSXF function on ix genotype, we sought to determine if IX interacts directly with DSXF to re gulate transcriptional targets such as the Yp genes. As a preliminary test for s uch an interaction, we used a yeast 2-hybrid assay to look for an interaction be tween IX and either the DSXF or DSXM proteins. Constructs fusing full-length IX, DSXF or DSXM proteins with the Gal4 activation or DNA-binding domains were crea ted and co-transformed into a yeast strain containing metabolic and enzymatic re porters for Gal4 function. Positive interactions were assayed by growth on restr ictive medium as well as by lacZ expression (see Materials and Methods). By thes e criteria, the IX fusion proteins exhibit positive homomeric interaction, and e xhibit heteromeric interaction with DSXF, but not DSXM, fusion proteins (Fig. 8A ). Control transformants, containing only single constructs, failed to demonstra te either growth on restrictive medium or lacZ expression. View larger version (61K): [in this window] [in a new window] Fig. 8. Interaction of IX and DSXF to form a DNA-binding complex. (A) Results from yeast two-hybrid analysis. Fusion constructs between IX, DSXF or DSXM prot ein-coding sequences and either the Gal4 activation domain coding sequence (colu mn 1) or the Gal4 DNA-binding domain coding sequence (column 2) were co-transfor med into yeast containing Ade, His and lacZ reporters. A minus sign in column 1 or 2 indicates that no construct bearing the given domain sequence was transform ed. The presence of an interaction between the fusion proteins (plus sign in col umn 3) was inferred by the ability of a transformed strain to grow on restrictiv e medium and to express lacZ, using a colony lift assay. (B) Co-immunoprecipitat ion of DSXF and IX. Nuclear extracts containing equivalent concentrations of pro tein from Drosophila S2 cells co-transfected with AU1-epitope-tagged IX and V5-e pitope-tagged DSXF (lane 2) or DSXM (lane 3) were immunoprecipitated with monocl onal anti-AU1 antibody and analyzed via western blot with rabbit polyclonal anti -V5. The band at approximately 57 kDa in lane 2 corresponds to DsxF-V5. Lane 4 c ontains the supernatant from extracts precipitated in lane 3, indicating that Ds xM-V5 protein was expressed but not precipitated with Ix-AU1. (C) DSXF and IX fo rm a DNA-binding complex. EMSA was performed by incubating nuclear extracts from S2 cells expressing DSXF-V5 and/or IX-AU1 with a 32P-labeled DNA probe containi ng the 185 bp FBE region of the Yp enhancer, and resolving by native PAGE. Lane 1, free probe (no extract); lanes 2-5, probe plus tagged protein (indicated abov e lanes). Extracts from cells co-transfected with DSXF-V5 and IX-AU1 were probed in the presence of anti-AU1 or anti-V5 monoclonal antibodies or mouse IgG (lane s 6-8, respectively) to assay super-shifting of the DNA-binding complex. To confirm the results of our two-hybrid assay, we performed co-immunoprecipitat ion of tagged IX and DSX proteins expressed in Drosophila S2 cells. Constructs c apable of expressing IX tagged with an AU1 epitope and either DSXF or DSXM tagge d with a V5 epitope were co-transfected into S2 cells, extracts of which were su bsequently immunoprecipitated using monoclonal anti-AU1 antibody. The immunoprec ipitates and supernatants were resolved via SDS-PAGE and analyzed by western blo t with polyclonal anti-V5. The AU1-epitope-tagged IX is able to co-immunoprecipi tate DSXF-V5 but not DSXM-V5, indicating that IX specifically forms a stable com plex with DSXF in vivo (Fig. 8B). Analysis of supernatants confirmed that all pr oteins were expressed upon induction. Because DSXF functions as a transcription factor, we sought to determine if the complex between IX and DSXF proteins is able to bind DNA effectively. We perform ed electrophoretic-mobility shift assay (EMSA) using as probe the previously cha racterized 185 bp FBE region of the Yp enhancer, which contains DSX-binding site s (Burtis et al., 1991). Nuclear extracts from S2 cells transfected with the epi tope-tagged constructs discussed above were incubated with 32P end-labeled FBE f ragments and resolved by native PAGE. A stable DNA-binding complex was seen in e xtracts containing IX and DSXF (Fig. 8C, lanes 1-5). To confirm that this comple x contained IX and DSXF, extracts were incubated with probe in the presence of o ne of three antibodies – anti-AU1, anti-V5 or nonspecific mouse IgG. That the predominant DNA-binding complex is specifically super-shifted by antibodies to the individual tags indicates that the complex contains minimally IX and DSXF (Fig. 8C, lanes 6-8). DISCUSSION TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES To begin to understand how ix regulates the terminal differentiation genes in fe males and how the sex-specificity of the ix phenotype is achieved, we have clone d the ix gene. The N-terminal 44 amino acids of IX share sequence similarity wit h the human and mouse synovial sarcoma translocation (SYT) proteins (Clark et al ., 1994; de Bruijn et al., 1996) and C. elegans SUR-2 (Singh and Han, 1995). The remainder of IX has sequence similarity to mammalian ESTs. The function of the genes represented by these ESTs is unknown. The SYT and SUR-2 proteins are proposed to function as transcription factors (Br ett et al., 1997; Singh and Han, 1995). Human SYT was first identified as a chim eric protein resulting from a chromosomal translocation that is implicated in sy novial sarcomas (Clark et al., 1994), and the region of the SYT protein that act ivates transcription in in vitro assays (Brett et al., 1997) contains the region with similarity to the ix protein. The SYT chimeric protein is nuclear, as expe cted for a transcription factor (Brett et al., 1997; dos Santos et al., 1997). A s SYT does not contain a known DNA-binding motif (Clark et al., 1994), it is tho ught to form a complex with a DNA-binding protein to activate transcription. The sequence similarity of IX to the human and mouse SYT proteins and to SUR-2 s uggests that ix may also act as a transcription activator. Additionally, like th e SYT proteins, IX does not contain a recognizable DNA-binding domain. dsx and h er function at the same position in the hierarchy as ix and these genes encode p roteins with zinc-finger DNA-binding domains (Erdman and Burtis, 1993; Li and Ba ker, 1998a). However, neither DSXF nor HER proteins can activate transcription a lone in 2-hybrid assays (this paper; H. Li, data not shown), suggesting these pr oteins lack activation domains and interact with additional proteins to regulate the expression of the terminal differentiation genes in females. The DSXM prote in has a 152 amino acid male-specific C terminus, whereas the smaller DSXF prote in has only 30 unique amino acids at its end (Burtis and Baker, 1989). Therefore , the DSXF protein may need to interact with a co-factor for female-specific act ivity. The genetic results in this paper, indicating that dsx and ix act interde pendently to regulate female-specific differentiation, and the biochemical resul ts, indicating the DSXF and IX physically interact, suggest that IX may be this co-factor. It remains to be determined whether the specific interaction of DSXF and IX is mediated through the 30 amino acid C terminus of DSXF. As the ix phenotype is female specific and expression of other genes in the soma tic sex determination hierarchy is controlled sex-specifically, expression of th e ix gene could have been sex-specifically regulated. However, XY flies expressi ng a cDNA corresponding to DSXF are phenotypically female (Waterbury et al., 199 9) instead of intersexual, suggesting that ix protein is present in these chromo somal males. Our analysis of ix cDNAs, northern hybridization and RNase protecti on assays demonstrated that the ix pre-mRNA is not sex-specifically spliced. The refore, the female-specific phenotype is not achieved through alternative proces sing of the ix transcript. The previous genetic results and our molecular result s suggest that the ix protein is present in both females and males and its femal e-specific function is mediated through interactions with the female-specific pr otein DSXF. Analysis of Yp gene expression demonstrated that dsx, her and ix control Yp gene expression in the fat body (An and Wensink, 1995; Burtis et al., 1991; Coschiga no and Wensink, 1993; Li and Baker, 1998b; Waterbury et al., 1999). Our results indicate that ix acts through the Yp intergenic region that contains the DSX-bin ding sites. Additionally, expression of DSXF in ix mutant males is not sufficien t to activate Yp expression (Waterbury et al., 1999), suggesting DSXF requires I X to regulate Yp expression. Our analysis of Yp reporter constructs in ix; dsx m utant females also suggests that IX and DSXF act together to control Yp gene tra nscription. Therefore, DSXF may require IX as a co-factor to directly regulate Y p gene expression in females. This possibility is supported by the observation t hat IX and DSXF are present in a complex that binds the region of the Yp FBE tha t contains DSX-binding sites. Phenotypic analysis of ix; dsx mutant females demonstrated that ix and dsx also cooperate to regulate female-specific differentiation of sexually dimorphic cuti cular structures. The ix mutation failed to masculinize the dsx mutant females, indicating that dsx is dependent on ix activity in the precursor cells that diff erentiate into the vaginal teeth, dorsal anal plates, last transverse row of bri stles on the basitarsus and sixth tergite pigment-producing cells. Additionally, the phenotypic analysis of ix mutant males confirmed that ix does not function in males. The possibility that ix also functions with her to control female-spec ific differentiation of some sexually dimorphic structures remains to be tested. The tight interdependence of DSXF and IX suggests that the relationship between HER and IX is likely to be the same as that between HER and DSX in females. Understanding of the role of the sex determination hierarchy in sex-specific dif ferentiation has been substantially revised and enhanced by recent studies that have begun to illuminate how information from the sex determination hierarchy is integrated with information from other developmental hierarchies. In particular , it had been thought that dsx played a mainly permissive role in the developmen t of the internal and external genitalia. These structures develop from the geni tal imaginal disc, which is composed of three primordia deriving from embryonic abdominal segments A8, A9 and A10. The classical view of the genital disc was th at the A8-derived primordium differentiated into female genital structures in fe males and was repressed in males, whereas the A9-derived primordium differentiat ed into male genital structures in males and was repressed in females; the A10-d erived primordium differentiates into anal structures appropriate to the sex of the individual. Thus, whereas the differentiation of the anal primordium require s an instructive cue from the sex hierarchy, the differentiation of the appropri ate genital primordium was inferred to require only a permissive function of the sex hierarchy, with segmental identity determining the structures that ultimate ly developed. This classical view was overturned by the finding that the ‘repre ssed’ genital primordium in each sex actually develops into adult structures: t he ‘repressed’ female (A8) primordium produces a miniature eighth tergite in m ales and the ‘repressed’ male (A9) primordium produces the parovaria in female s (Keisman et al., 2001). Consistent with its instructive role, the sex hierarch y actively modulates the regulation by other developmental pathways of sex-speci fically deployed genes. The dachshund (dac) gene is differentially expressed in the male and female genital discs, and the sex hierarchy mediates this sex-speci fic deployment by determining cell-autonomously whether dac is activated by wing less signaling (in females) or by decapentaplegic signaling (in males) (Keisman and Baker, 2001). Fibroblast growth factor (FGF) signaling in the genital disc i s also regulated cell-autonomously by the sex hierarchy (Ahmad and Baker, 2002). DSXF represses the FGF-encoding branchless (bnl) gene, thus restricting bnl-exp ressing cells to the male genital disc. FGF signaling from these cells recruits into the disc mesodermal cells expressing the FGF receptor encoded by the breath less (btl) gene. Once inside the male genital disc, these btl-expressing cells b ecome epithelial and eventually give rise to the paragonia and vas deferens, com ponents of the internal male genitalia. An instructive role for the sex hierarch y is also evident in an adult tissue not derived from the genital imaginal disc. The bric à brac (bab) locus integrates signals from the homeotic genes, as wel l as the sex hierarchy to repress pigmentation of tergites 5 and 6 in females (K opp et al., 2000). Although the Yp genes, which are activated by DSXF and repressed by DSXM, are th e only known direct target of dsx, it is likely that DSXF acts in some cases to repress transcription and that DSXM acts in some cases to activate transcription . Indeed, if the examples above represent cases of direct regulation, then it is clear that the effect of DSXF or DSXM is dependent upon both the cellular conte xt and the promoter organization of the target gene. Such context-dependent dual ity of function finds precedent in several well characterized transcription fact ors. The mechanisms that determine whether a bi-functional transcription factor is in an activating or repressing state are diverse, and include binding of liga nd co-factors, differential organization of binding sites in promoters, interact ion with other DNA-binding factors, and concentration-dependent structural chang es (Roberts and Green, 1995). The DSX proteins provide an especially interesting case of dual regulatory activity because not only are DSXF and DSXM each capabl e of activating some target genes and repressing others, but the two isoforms of ten have opposite effects, with DSXF repressing those genes that DSXM activates and vice versa. It may be that IX, functioning as a co-factor for DSXF, plays a key role in effecting this symmetry of dual regulatory activities. ACKNOWLEDGMENTS The authors thank Mike Simon, Margaret Fuller, Pam Carroll, Lisa Ryner, Axel Fra nke and members of the Baker laboratory for helpful discussions; Guennet Bohm fo r the preparation of culture media and fly food; and Pieter Wensink, Marie Lossk y, Ken Burtis and Delphine Fagegaltier for reagents. This work was supported by an NIH Developmental and Neonatal Training Grant (C. M. G.-E.), a NSF/Sloan Foun dation Postdoctoral Fellowship and NIH NRSA Postdoctoral Fellowship (M. L. S.), the Medical Scientist Training Program (D. S. M.) and by an NIH grant to B. S. B . REFERENCES TOP SUMMARY INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanat ides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F. et al. (200 0). The genome sequence of Drosophila melanogaster. Science 287, 2185-2195.[Abst ract/Full Text] Ahmad, S. M. and Baker, B. S. (2002). Sex-specific deployment of FGF signaling i n Drosophila recruits mesodermal cells into the male genital imaginal disc. Cell 109, 651-661.[Medline] An, W. and Wensink, P. C. (1995). Integrating sex- and tissue-specific regulatio n within a single Drosophila enhancer. Genes Dev. 9, 256-266.[Abstract] Ashburner, M. (1989). Drosophila: A Laboratory Manual. Cold Spring Harbor, NY: C old Spring Harbor Laboratory Press. Baker, B. S. and Ridge, K. (1980). Sex and the single cell: On the action of maj or loci affecting sex determination in Drosophila melanogaster. Genetics 94, 383 -423.[Medline] Brett, D., Whitehouse, S., Antonson, P., Shipley, J., Cooper, C. and Goodwin, G. (1997). The SYT protein involved in the t(X;18) synovial sarcoma translocation is a transcriptional activator localised in nuclear bodies. Hum. Mol. Genet. 6, 1559-1564.[Abstract/Full Text] Bridges, C. B. and Bridges, P. N. (1939). A new map of the second chromosome: a revised map of the right limb of the second chromosome of Drosophila Melanogaste r. J. Hered. 30, 475-476. Burtis, K. C. and Baker, B. S. (1989). Drosophila doublesex gene controls somati c sexual differentiation by producing alternatively spliced mRNAs encoding relat ed sex-specific polypeptides. Cell 56, 997-1010.[Medline] Burtis, K. C., Coschigano, K. T., Baker, B. S. and Wensink, P. C. (1991). The do ublesex proteins of Drosophila melanogaster bind directly to a sex-specific yolk protein gene enhancer. EMBO J. 10, 2577-2582.[Abstract] Chase, B. A. and Baker, B. S. (1995). A genetic analysis of intersex, a gene reg ulating sexual differentiation in Drosophila melanogaster females. Genetics 139, 1649-1661.[Abstract/Full Text] Clark, J., Rocques, P. J., Crew, A. J., Gill, S., Shipley, J., Chan, A. M., Gust erson, B. A. and Cooper, C. S. (1994). Identification of novel genes, SYT and SS X, involved in the t(X;18)(p11.2;q11.2) translocation found in human synovial sa rcoma. Nat. Genet. 7, 502-508.[Medline] Cline, T. W. and Meyer, B. J. (1996). Vive la différence: males vs females in f lies vs worms. Annu. Rev. Genet. 30, 637-702.[Abstract/Full Text] Coschigano, K. T. and Wensink, P. C. (1993). Sex-specific transcriptional regula tion by the male and female doublesex proteins of Drosophila. Genes Dev. 7, 42-5 4.[Abstract] de Bruijn, D. R., Baats, E., Zechner, U., de Leeuw, B., Balemans, M., Olde Weghu is, D., Hirning-Folz, U. and Geurts van Kessel, A. G. (1996). Isolation and char acterization of the mouse homolog of SYT, a gene implicated in the development o f human synovial sarcomas. Oncogene 13, 643-648.[Medline] Deiss, L. P., Feinstein, E., Berissi, H., Cohen, O. and Kimchi, A. (1995). Ident ification of a novel serine/threonine kinase and a novel 15-kD protein as potent ial mediators of the gamma interferon-induced cell death. Genes Dev. 9, 15-30.[A bstract] dos Santos, N. R., de Bruijn, D. R., Balemans, M., Janssen, B., Gartner, F., Lop es, J. M., de Leeuw, B. and Geurts van Kessel, A. (1997). Nuclear localization o f SYT, SSX and the synovial sarcoma-associated SYT-SSX fusion proteins. Hum. Mol . Genet. 6, 1549-1558.[Abstract/Full Text] Erdman, S. E. and Burtis, K. C. (1993). The Drosophila doublex proteins share a novel zinc finger related DNA binding domain. EMBO J. 12, 527-535.[Abstract] Erdman, S. E., Chen, H. J. and Burtis, K. C. (1996). Functional and genetic char acterization of the oligomerization and DNA binding properties of the Drosophila Doublesex proteins. Genetics 144, 1639-1652.[Abstract/Full Text] Garabedian, M. J., Sheperd, B. M. and Wensink, P. C. (1986). A tissue-specific t ranscription enhancer from the Drosophila yolk protein 1 gene. Cell 45, 859-867. [Medline] Hays, T. S., Deuring, R., Robertson, B., Prout, M. and Fuller, M. T. (1989). Int eracting proteins identified by genetic interactions: a missense mutation in -tu bulin fails to complement alleles of the testis-specific ß-tubulin gene of Drosophila melanogaster. Mol. Cell. Biol. 9, 875-884.[Medline] Huang, D. Y. and Prystowsky, M. B. (1996). Identification of an essential cis-el ement near the transcription start site for transcriptional activation of the pr oliferating cell nuclear antigen gene. J. Biol. Chem. 271, 1218-1225.[Abstract/F ull Text] Jallon, J.-M., Lauge, G., Orssaud, L. and Antony, C. (1988). Female pheromones i n Drosophila melanogaster are controlled by the doublesex locus. Genet. Res. 51, 17-22. Keisman, E. L. and Baker, B. S. (2001). The Drosophila sex determination hierarc hy modulates wingless and decapentaplegic signaling to deploy dachshund sex-spec ifically in the genital imaginal disc. Development 128, 1643-1656.[Abstract] Keisman, E. L., Christiansen, A. E. and Baker, B. S. (2001). The sex determinati on gene doublesex regulates the A/P organizer to direct sex-specific patterns of growth in the Drosophila genital imaginal disc. Dev. Cell 1, 215-225.[Medline] Kopp, A., Duncan, I. and Carroll, S. B. (2000). Genetic control and evolution of sexually dimorphic characters in Drosophila. Nature 408, 553-559.[Medline] Laski, F. A., Rio, D. C. and Rubin, G. M. (1986). Tissue specificity of Drosophi la P element transposition is regulated at the level of mRNA splicing. Cell 44, 7-19.[Medline] Li, H. and Baker, B. S. (1998a). her, a gene required for sexual differentiation in Drosophila, encodes a zinc finger protein with characteristics of ZFY-like p roteins and is expressed independently of the sex determination hierarchy. Devel opment 125, 225-235.[Abstract] Li, H. and Baker, B. S. (1998b). hermaphrodite and doublesex function both depen dently and independently to control various aspects of sexual differentiation in Drosophila. Development 125, 2641-2651.[Abstract] Lindsley, D. L. and Zimm, G. (1992). The Genome of Drosophila melanogaster. San Diego, CA: Academic Press. Lossky, M. and Wensink, P. C. (1995). Regulation of Drosophila yolk protein gene s by an ovary-specific GATA factor. Mol. Cell. Biol. 15, 6943-6952.[Abstract] Marín, I. and Baker, B. S. (1998). The evolutionary dynamics of sex determinati on. Science 281, 1990-1994.[Abstract/Full Text] Mosher, J. and Crews, S. (1999). Effectene reagent yields high transfection effi ciencies with Drosophila melanogaster S2 cells. Qiagen News 4, 7-10. Nagoshi, R. N., McKeown, M., Burtis, K. C., Belote, J. M. and Baker, B. S. (1988 ). The control of alternative splicing at genes regulating sexual differentiatio n in D. melanogaster. Cell 53, 229-236.[Medline] O’Connell, P. and Rosbash, M. (1984). Sequence, structure, and codon preference of the Drosophila ribosomal protein 49 gene. Nucleic Acids Res. 12, 5495-5513.[ Abstract] O’Tousa, J. E., Baehr, W., Martin, R. L., Hirsh, J., Pak, W. L. and Applebury, M. L. (1985). The Drosophila ninaE gene encodes an opsin. Cell 40, 839-850.[Medl ine] Pirrotta, V. (1988). Vectors for P-mediated transformation in Drosophila. In Vec tors, a Survey of Molecular Cloning Vectors and their Uses (ed. R. L. Rodriguez and D. T. Denhardt), pp. 437-456. Boston, MA: Butterworths. Pultz, M. A. and Baker, B. S. (1995). The dual role of hermaphrodite in the Dros ophila sex determination regulatory hierarchy. Development 121, 99-111.[Abstract ] Pultz, M. A., Carson, G. S. and Baker, B. S. (1994). A genetic analysis of herma phrodite, a pleiotropic sex determination gene in Drosophila melanogaster. Genet ics 136, 195-207.[Abstract/Full Text] Roberts, S. G. E. and Green, M. R. (1995). Dichotomous regulators. Nature 375, 1 05-106.[Medline] Rubin, G. M. and Spradling, A. C. (1982). Genetic transformation of Drosophila w ith transposable element vectors. Science 218, 348-353.[Medline] Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Labor atory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Singh, N. and Han, M. (1995). sur-2, a novel gene, functions late in the let-60 ras-mediated signaling pathway during Caenorhabditis elegans vulval induction. G enes Dev. 9, 2251-2265.[Abstract] Spradling, A. C. and Rubin, G. M. (1982). Transposition of cloned P elements int o Drosophila germ line chromosomes. Science 218, 341-347.[Medline] Stearns, T. and Botstein, D. (1988). Unlinked noncomplementation: isolation of n ew conditional-lethal mutations in each of the tubulin genes of Saccharomyces ce revisiae. Genetics 119, 249-260.[Abstract/Full Text] Taylor, B. J. and Truman, J. W. (1992). Commitment of abdominal neuroblasts in D rosophila to a male of female fate is dependent on genes of the sex-determining hierarchy. Development 114, 625-642.[Abstract] Torok, T., Tick, G., Alvarado, M. and Kiss, I. (1993). P-lacW insertional mutage nesis on the second chromosome of Drosophila melanogaster: isolation of lethals with different overgrowth phenotypes. Genetics 135, 71-80.[Abstract/Full Text] Villella, A. and Hall, J. C. (1996). Courtship anomalies caused by doublesex mut ations in Drosophila melanogaster. Genetics 143, 331-344.[Abstract/Full Text] Wang, S., Magoulas, C. and Hickey, D. (1999). C

  • 众说风云 (已有0条评论)
Master

人物

成功的秘诀

Train to gain

招聘

为你的职业拓宽道路

分子生物学相关产品



定量PCR仪

Eppendorf Ep Master
定量PCR仪

实时定量PCR仪

ABI Stepone TM 实时定量PCR仪,最新的软件系统,界面友好,操作简单

PCR产物纯化

各种厂家和各种规格的PCR产物纯化试剂盒


定量PCR试剂

最全的定量PCR试剂


荧光定量PCR全套服务方案

从引物设计到实验全程服务