Primers:
ABI Forward primer sequence- 20mer 5' GACGTTGTAAAACGACGGCC 3' 18mer 5' TGTAAAACGACGGCCAGT 3' ABI Forward Aminolink-primer sequence- 5' 5TG TAA AAC GAC GGC CAG T 3' ABI Reverse primer sequence- 20mer 5' CACAGGAAACAGCTATGACC 3' 18mer 5' CAGGAAACAGCTATGACC 3' ABI Reverse Aminolink-primer sequence- 5' 5CA GGA AAC AGC TAT GAC C 3'Taq Cycle Sequencing Reagent Preparation
1. 5X Taq Reaction buffer400 mM Tris-HCl, pH 9.0 16 ml 1 M Tris-HCl, pH 9.0 100 mM (NH4)2SO4, pH 9.0 4 ml 1 M (NH4)2SO4, pH 9.0 25 mM MgCl2, pH 7.0 1 ml 1 M MgCl2, pH 7.0 5% DMSO 2 ml DMSO 17 ml ddH2O 40 mlThe 5X Taq reaction buffer will be added separately with the A, C, G, and T nucleotide mixes for ease in reaction pipetting. One 40 ml preparation of buffer will be sufficient for one batch (about 200 tubes) of A, C, G, and T mix aliquots.2. Taq Dilution Buffer
400 mM Tris-HCl, pH 9.0 16 ml 1 M Tris-HCl, pH 9.0 100 mM (NH4)2SO4, pH 9.0 4 ml 1 M (NH4)2SO4, pH 9.0 25 mM MgCl2, pH 7.0 1 ml 1 M MgCl2, pH 7.0 19 ml ddH2O 40 mlThis is routinely distributed into 30 ul aliquots in clear, unlabeled 0.5 ml microcentrifuge tubes (about 200 per batch).3. 50:1 TE
50 mM Tris-HCl, pH 7.6 0.5 ml 1 M Tris-HCl, pH 7.6 1 mM Na2EDTA, pH 8.0 0.1 ml 0.1 M Na2EDTA, pH 8.0 9.6 ml ddH2O 10 ml4. Fluorescent Labeled Primers
Prepare a 100 X stock solution (40 uM); an example calculation for a dry tube of an 18mer with an O.D. of 1.00 is shown below (remembering that Joe is the dye-labeled primer for the A reaction, Fam is for C, Tamra is for G, and Rox is for T):
1.00 OD(37 ug/OD)(mol x mer/320 g)(10+12pmol/mol)(g/10+6ug)
(1/18 mer)(ul/40 pmoles)=x ul
In this example x=160 ul, and 160 ul of ddH20 should be added to the dried tube of fluorescent primer for a concentration of 40 uM (40 pmol/ul). From this 100X stock of 40 uM make 1:100 dilutions. To make the amount of primer aliquoted the same as the amount of mixes per batch:
Dilute either fluorescent forward or reverse primers as follows:
64 ul of 40 uM A or C primer 128 ul of 40 uM G or T primer 6.3 ml ddH2O 12.7 ml ddH2O 6.4 ml 12.8 mlFor the A and C primers, distribute the 1X (0.4 uM solution) into 30 ul aliquots, and for the G and T primers, distribute them into 60 ul aliquots. The primers aliquots are stored in clear 0.5 ml microcentrifuge tubes which are labeled with blue, green, red, or yellow markers for A, C, G, or T primers, respectively. (Note: The current primers work optimally at the effective concentration of 0.4 uM, however with each new fluorescent primer preparation, the optimal concentration must be determined). The primers should be stored at 20 or -70degC.5. 5X Taq Cycle Sequencing Mixes Working dilutions of 20 mM are made for dATP, dCTP, and dTTP based on using one complete tube of 20 mM stock per batch of mixes. 7deaza-dGTP is purchased at a concentration of 10 mM (1080 ul are needed for one batch each of A, C, G, and T mixes, so slightly more than five tubes will be needed-each tube contains 200 ul).
20 mM dATP 20 mM dCTP 20 mM dTTP 95 ul of 100 mM dATP 95 ul of 100 mM dCTP 80 ul of 100 mM dTTP 47.5 ul of 50:1 TE 47.5 ul of 50:1 TE 40 ul of 50:1 TE 332.5 ul ddH2O 332.5 ul ddH2O 280 ul ddH2O 475 ul 475 ul 400 ulThe concentration of deoxy and dideoxy nucleotides in the mixes are shown below, followed by the recipe for one 200 tube batch of each of the four mixes.A C G T dATP 62.5 uM 250 uM 250 uM 250 uM dCTP 250 uM 62.5 uM 250 uM 250 uM 7-dGTP 375 uM 375 uM 94 uM 375 uM dTTP 250 uM 250 uM 250 uM 62.5 uM ddATP 1.5 mM -- -- -- ddCTP -- 0.75 mM -- -- ddGTP -- -- 0.125 mM -- ddTTP -- -- -- 1.25 mM For one batch (200 tubes) of each nucleotide mix: A C G T 20 mM dATP 20 ul 80 ul 160 ul 160 ul 20 mM dCTP 80 ul 20 ul 160 ul 160 ul 10 mM 7-dGTP 240 ul 240 ul 120 ul 480 ul 20 mM dTTP 80 ul 80 ul 160 ul 40 ul 5 mM ddATP 1920 ul -- -- -- 5 mM ddCTP -- 960 ul -- -- 5 mM ddGTP -- -- 320 ul -- 5 mM ddTTP -- -- -- 3200 ul 50:1 TE 640 ul 640 ul 1280 ul 1280 ul ddH2O 3420 ul 4380 ul 10600 ul7480 ul 6400 ul 6400 ul 12800 ul12800 ulTo each of these mix solutions, and equal volume of 5X Taq reaction buffer is added (with DMSO), so 6.4 ml is added to A and C, and 12.8 ml is added to G and T. This mix/buffer solution is distributed into 0.5 ml colored microcentrifuge tubes (blue for A, green for C, purple for G, and yellow for T) in 60 or 120 ul aliquots (60 for A and C/120 for G and T). The simplest way to distribute the 60 ul aliquots is 2 x 30 ul using the Eppendorf repeat pipettor set on 3 with the 0.5 ml Combitips, and for the 120 ul aliquots use 1 x 100 ul with the 5 ml Combitip plus 1 x 20 ul with the 0.5 ml Combitip. The mixes should be stored at -20 or -70degC.Ordering information:
100 mM dATP 27-2050-01 $48 Pharmacia 25 umoles 250 ul 100 mM dCTP 27-2060-01 $48 Pharmacia 25 umoles 250 ul 10 mM c7dGTP 988 537 $98 Boehringer 2 umoles 200 ul 100 mM dTTP 27-2080-01 $48 Pharmacia 25 umoles 250 ul 5 mM ddATP 27-2057-00 $25 Pharmacia 0.5 umoles 100 ul 5 mM ddCTP 27-2065-00 $25 Pharmacia 0.5 umoles 100 ul 5 mM ddGTP 27-2075-00 $25 Pharmacia 0.5 umoles 100 ul 5 mM ddTTP 27-2085-00 $25 Pharmacia 0.5 umoles 100 ul Micro PCR tubes 1044-20-0 $90 Robbins 1000/bag 10 rxn/bag StripEase caps 1044-10-0 $65 Robbins 300/bag 25 rxn/bagBulk reagents from Pharmacia (cust. no. 6933) (1-800-526-3593) are ordered, with the usual $750 ceiling, and these bulk orders sometimes require a week or two to be filled. Reagents from Boehringer Mannheim (cust. no. 66155-01) (1-800-262-1640) are usually processed overnight. Cycle sequencing tubes from Robbins Scientific (cust. no. 19800-3) (1-800-752-8585):
Oligonucleotide universal primers used for DNA sequencing
At present, we are using the following primers:
Universal Forward 20mer 5' GTTGTAAAACGACGGCCAGT 3'
Universal Reverse 20mer 5' CACAGGAAACAGCTATGACC 3'
The following primers also have been used in the past:
ABI Forward primer sequence-
20mer 5' GACGTTGTAAAACGACGGCC 3'
18mer 5' TGTAAAACGACGGCCAGT 3'
ABI Reverse primer sequence-
20mer 5' CACAGGAAACAGCTATGACC 3'
18mer 5' CAGGAAACAGCTATGACC 3'
T7: 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3'
SP6:5'-ATT-TAG-GTG-ACA-CTA-TAG-AA-3'
M13 (-21) universal forward 5'-TGT-AAA-ACG-ACG-GCC-AGT-3'
M13 (-40) universal forward 5'-GTT-TTC-CCA-GTC-ACG-AC-3'
M13/pUC reverse primer 5'-CAG-GAA-ACA-GCT-ATG-ACC-3'
T7 primer 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3'
SP6 primer 5'-ATT-TAG-GTG-ACA-CTA-TAG-3'
-16bs 5'-TCG-AGG-TCG-ACG-GTA-TCG-3'
+19bs 5'-GCC-GCT-CTA-GAA-CTA-GTG-3'
Listing of M13 (pUC) cloning sites
As they are read on DNA sequencing gels using the Universal primer:
M13mp7 .......EcoR1....BamH1.SalI..PstI..SalI..BamH1....EcoR1 GGCCAGTGAATTCCCCGGATCCGTCGACCTGCAGGTCGACGGATCCGGGGAATTC M13mp8 ..........HindIII.PstI.SalI...BamH1.SmaI.EcoR GGCCAGTGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAATTCGTAATCATG M13mp9 .......EcoR1.SmaI.BamH1..SalI..PstI..HindIII GGCCAGTGAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCGTAATCATGM13mp10 ...HindIII..PstI..SalI..XbaI..BamH1..SmaI..SstI..EcoR1 GCCAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGCGAGCTCGAATTCG M13mp11 ...EcoR1..SstI..SmaI..BamH1..XbaI..SalI..PstI..HindIII GTGAATTCGAGCTCGCCCGGGGATCCTCTAGAGTCGACCTGCAGCCCAAGCTTGG M13mp18 HindIII.SphI..PstI..SalI.XbaI.BamH1.SmaI.KpnI.SstI.EcoR1 AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC M13mp19 EcoR1.SstI.KpnI.SmaI.BamH1.XbaI.SalI.PstI..SphI..HindIII GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT
Commonly used restriction enzymes and assay buffers
Common Assay Incub. Recognition
Enzyme isoschizomers buffer temp. site Cloning sites
Aat II med 37 GACGT/C Aat II Acc I med 37 GT/(AC)(GT)AC Acc I, Cla I Aha III Dra I med 37 TTT/AAA blunt Alu I med 37 AG/CT blunt Asu II 37 TT/CGAA Acc I, Cla I Ava I med 37 C/YCGRG Sal I, Xho I, Xma I Ava II med 37 G/G(AT)CC Bal I low 37 TGG/CCA blunt BamH1 med 37 G/GATCC BamH1, Bgl II Bgl I med 37 GCCN4/NGGC Bgl II low 37 A/GATCT BamH1, Bgl II BstE II high 60 G/GTNACC BstN I low 55 CC/(AT)GG Cla I low 37 AT/CGAT Acc I, Cla I Dra I Aha III low 37 TTT/AAA blunt EcoR1 high 37 G/AATTC EcoR1 EcoR1* low 37 /AATT EcoR1 EcoRV med 37 GAT/ATC blunt Hae I low 37 (AT)GG/CC(TA) blunt Hae II low 37 RGCGC/Y Hae III med 37 GG/CC blunt Hha I Cfo I, HinP1 med 37 GCG/C Hha I Hinc II med 37 GTY/RAC blunt Hind III med 37-55 A/AGCTT Hind III Hinf I med 37 G/ANTC HinP1 Cfo I, Hha I low 37 G/CGC Acc I, Cla I Hpa I low 37 GTT/AAC blunt Hpa II Msp I low 37 C/CGG Acc I, Cla I Kpn I low 37 GGTAC/C Kpn I Mbo I Sau3A med 37 /GATC BamH1, Bgl II Msp I med 37 C/CGG Acc I, Cla I Mst I Fsp I high 37 TGC/GCA blunt Mst II Bsu36 I high 37 CC/TNAGG Nae I med 37 GCC/CCG blunt Nco I high 37 C/CATGG Nco I Nde I med 37 CA/TATG Nde I Not I high 37 GC/GGCCGC Nru I med 37 TCG/CGA blunt Pst I med 21-37 CTGCA/G Pst I Pvu I high 37 CGAT/CG Pvu I Pvu II med 37 CAG/CTG blunt Rsa I med 37 GT/AC blunt Sac I Sst I low 37 GAGCT/C Sac I, Sst I Sal I high 37 G/TCGAC Ava I, Sal I, Xho I Sau3A I Mbo I med 37 /G*ATC BamH1, Bgl II Sfi I 50 GGCCN4/NGGCC Sma I Xma I (1) 37 CCC/GGG blunt Sph I high 37 GCATG/C Sph I Sst I Sac I med 37 GAGCT/C Sst I, Sac I Sst II Sac II med 37 CCGC/GG Sst II Taq I low 37-55 T/CGA AccI, Cla I Tha I FnuD II, Acc II low 37-60 CG/CG blunt Xba I high 37 T/CTAGA Xba I Xho I Ccr I high 37 C/TCGAG Ava I, Cla I Xma I Sma I low 37 C/CCGGG Ava I, Xma IAssay buffers (see enzyme vendors catalogs for additional information)
10x Low salt buffer 10x Core buffer 100mM Tris-HCl, pH 7.6 500mM NaCl 100mM MgCl2 500mM Tris-HCl, pH 7.6 10mM DTT 100mM MgCl2 10x Medium salt buffer 10x Hind buffer 500mM NaCl 600mM NaCl 100mM Tris-HCl, pH 7.6 100mM Tris-HCl, pH 7.6 100mM MgCl2 70mM MgCl2 10mM DTT10x High salt buffer 10x Sma I buffer (1) 1.0M NaCl 200mM KCl 500mM Tris-HCl, pH 7.6 100mM Tris-HCl, pH 7.6 100mM MgCl2 100mM MgCl2 10mM DTT 10mM DTT
The following enzymes CAN be heat inactivated by incubation at 65 deg. C for 10 min.
Alu I, Apa I, Ava II, Bal I, Bgl I, Cvn I, Dpn I, Dra I, Eco R II, Eco RV, Hae II, Hha I, Hinc II, Kpn I, Mbo I, Msp I, Nar I, Nde II, Rsa I, Sau 3a, Sca I, Sfi I, Spe I, Sph I, Ssp I, Sst I, Stu I, and Sty I.
The following enzymes are ONLY PARTIALLY heat inactivated by incubation at 65 deg.C for 10 min.
Ava I, Cfo I, Cla I, Cvn I, Eco RI, Mbo II, Mlu I, Nci I, Nru I, Pst I, Pvu II, Sma I and Xma III
The following enzymes CANNOT be heat inactivated by incubation at 65 deg. C for 10 min.
Acc I, Bam HI, Bcl I, Bgl II, BstE II, Dde I, Hae III, Hind III, Hinf I, Hpa I, Hpa II Nde I, Nhe I, Nsi I, Pvu I, Sal I, Sau 96 I, Sst II, Taq I, Tha I, Xba I, Xho I, and Xor II.
Bacterial Transformation and Transfection
Bacterial transformation is the process by which bacterial cells take up naked DNA molecules. If the foreign DNA has an origin of replication recognized by the host cell DNA polymerases, the bacteria will replicate the foreign DNA along with their own DNA. When transformation is coupled with antibiotic selection techniques, bacteria can be induced to uptake certain DNA molecules, and those bacteria can be selected for that incorporation. Bacteria which are able to uptake DNA are called "competent" and are made so by treatment with calcium chloride in the early log phase of growth. The bacterial cell membrane is permeable to chloride ions, but is non-permeable to calcium ions. As the chloride ions enter the cell, water molecules accompany the charged particle. This influx of water causes the cells to swell and is necessary for the uptake of DNA. The exact mechanism of this uptake is unknown. It is known, however, that the calcium chloride treatment be followed by heat. When E. coli are subjected to 42degC heat, a set of genes are expressed which aid the bacteria in surviving at such temperatures. This set of genes are called the heat shock genes. The heat shock step is necessary for the uptake of DNA. At temperatures above 42degC, the bacteria's ability to uptake DNA becomes reduced, and at extreme temperatures the bacteria will die.
Plasmid Transformation and Antibiotic Selection
The process for the uptake of naked plasmid and bacteriophage DNA is the same; calcium chloride treatment of bacterial cells produces competent cells which will uptake DNA after a heat shock step. However, there is a slight, but important difference in the procedures for transformation of plasmid DNA and bacteriophage M13 DNA. In the plasmid transformation, after the heat shock step intact plasmid DNA molecules replicate in bacterial host cells. To help the bacterial cells recover from the heat shock, the cells are briefly incubated with non-selective growth media. As the cells recover, plasmid genes are expressed, including those that enable the production of daughter plasmids which will segregate with dividing bacterial cells. However, due to the low number of bacterial cells which contain the plasmid and the potential for the plasmid not to propogate itself in all daughter cells, it is necessary to select for bacterial cells which contain the plasmid. This is commonly performed with antibiotic selection. E. coli strains such as GM272 are sensitive to common antibiotics such as ampicillin. Plasmids used for the cloning and manipulation of DNA have been engineered to harbor the genes for antibiotic resistance. Thus, if the bacterial transformation is plated onto media containing ampicillin, only bacteria which possess the plasmid DNA will have the ability to metabolize ampicillin and form colonies. In this way, bacterial cells containing plasmid DNA are selected.
Bacteriophage M13 Transformation and Viral Transfection
The transformation of bacteriophage M13 into bacterial cells is identical to plasmid DNA transformation through the heat shock step. After the heat shock step, single stranded M13 DNA begins replicating in the host cell through use of the host cell machinery. During the life cycle of this virus, however, M13 replicative form is created and daughter phages are packaged and extruded from the bacterial cell. These intact phage molecules then infect neighboring bacteria in a process called transfection. When these transformed and transfected bacteria are plated with non-infected cells onto growth media, the non-infected cells form a background cell lawn which covers the plate. In regions of M13 transfection, areas of slowed growth, called plaques, can be identified as opaque regions which interrupt the lawn.
Bacterial Strains
Since M13 viral transfection is a critical part of the transformation of bacterial cells with M13, it is absolutely necessary to use a strain of E. coli which harbors the episome for the F pilus. When M13 phages infect bacterial cells they attach to the F pilus, and the loss of this pilus is a common reason for a failed or poor transformation/transfection of M13. JM101 is a strain of E. coli which possesses the F pilus if the culture is maintained under appropriate conditions. Since the F pilus is not necessary for plasmid DNA transformation, it is advisable to use GM272, a much healthier, F- strain of E. coli for this procedure. To avoid confusion between the similar procedures, bacterial transformation with plasmid DNA is termed a "Transformation", and a bacterial transformation with naked M13 followed by a transfection with intact M13 phage is called a "Transfection."
Plasmid Transformation and Antibiotic Selection
Lac Z Operon
An additional level of selection can be achieved during transformation and transfections. Bacterial cells containing plasmids with the antibiotic resistance gene are selected in bacterial transformations, and cells in an area of M13 infection are recognized as plaques against a lawn of non-infected cells. However, the object of most transformations and transfections is to clone foreign DNA of interest into a known plasmid or viral vector and to isolate cells containing those recombinant molecules from each other and from those containing the non-recombinant vector. The E. coli lacZ operon has been incorporated into several cloning vectors, including plasmid pUC and bacteriophage M13. The polylinker regions of these vectors was engineered inside of the lacZ gene coding region, but in a way not to interrupt the reading frame or the functionality of the resultant lacZ gene protein product. This protein product is a galactosidase. In recombinant vectors which have an insert DNA molecule cloned into one of the restriction enzyme sites in the polylinker, this insert DNA results in an altered lacZ gene and a non-functional galactosidase. The presence or absence of this protein can easily be determined through the use of a simple chromogenic assay using IPTG and X-Gal. IPTG is the lacZ gene inducer and is necessary for the production of the galactosidase. The usual substrate for the lacZ gene protein product is galactose, which is metabolized into lactose and glucose. X-Gal is a colorless, modified galactose sugar. When this molecule is metabolized by the galactosidase, the resultant products are a bright blue color.
When IPTG and X-Gal are included in a plasmid DNA transformation, blue colonies represent bacteria harboring non-recombinant pUC vector DNA since the lacZ gene region is intact. IPTG induces production of the functional galactosidase which cleaves X-Gal and results in a blue colored metobolite. It follows that colorless colonies contain recombinant pUC DNA since a nonfunctional galactosidase is induced by IPTG which is unable to cleave the X-Gal. Similarly, for bacteriophage transfections, colorless plaques indicate regions of infection with recombinant M13 viruses, and blue plaques represent infection with non-recombinant M13.
Host Mutation Descriptions:
ara Inability to utilize arabinose.
deoR Regulatory gene that allows for constitutive synthesis for genes involved in deoxyribose synthesis. Allows for the uptake of large plasmids.
endA DNA specific endonuclease I. Mutation shown to improve yield and quality of DNA from plasmid minipreps.
F' F' episome, male E. coli host. Necessary for M13 infection.
galK Inability to utilize galactose.
galT Inability to utilize galactose.
gyrA Mutation in DNA gyrase. Confers resistance to nalidixic acid.
hfl High frequency of lysogeny. Mutation increases lambda lysogeny by inactivating specific protease.
lacI Repressor protein of lac operon. LacI[q]is a mutant lacI that overproduces the repressor protein.
lacY Lactose utilization; galactosidase permease (M protein).
lacZ b-D-galactosidase; lactose utilization. Cells with lacZ mutations produce white colonies in the presence of X-gal; wild type produce blue colonies.
lacZdM15 A specific N-terminal deletion which permits the a-complementation segment present on a phagemid or plasmid vector to make functional lacZ protein.
Dlon Deletion of the lon protease. Reduces degradation of b-galactosidase fusion proteins to enhance antibody screening of l libraries.
malA Inability to utilize maltose.
proAB Mutants require proline for growth in minimal media.
recA Gene central to general recombination and DNA repair. Mutation eliminates general recombination and renders bacteria sensitive to UV light.
rec BCD Exonuclease V. Mutation in recB or recC reduces general recombination to a hundredth of its normal level and affects DNA repair.
relA Relaxed phenotype; permits RNA synthesis in the absence of protein synthesis.
rspL 30S ribosomal sub-unit protein S12. Mutation makes cells resistant to streptomycin. Also written strA.
recJ Exonuclease involved in alternate recombination pathways of E. coli.
strA See rspL.
sbcBC Exonuclease I. Permits general recombination in recBC mutants.
supE Supressor of amber (UAG) mutations. Some phage require a mutation in this gene in order to grow.
supF Supressor of amber (UAG) mutations. Some phage require a mutation in this gene in order to grow.
thi-1 Mutants require vitamin B1(thiamine) for growth on minimal media.
traD36 mutation inactivates conjugal transfer of F' episome.
umuC Component of SOS repair pathway.
uvrC Component of UV excision pathway.
xylA Inability to utilize xylose.
Restriction and Modification Systems
dam DNA adenine methylase/ Mutation blocks methylation of Adenine residues in the recognition sequence 5'-G*ATC-3' (*=methylated)
dcm DNA cytosine methylase/Mutation blocks methylation of cytosine residues in the recognition sequences 5'-C*CAGG-3' or 5'-C*CTGG-3' (*=methylated)
hsdM E. coli methylase/ Mutation blocks sequence specific methylation A[N6]*ACNNNNNNGTGC or GC [N6]*ACNNNNNNGTT (*=methylated). DNA isloated from a HsdM[-] strain will be restricted by a HsdR[+]host.
hsd R17 Restriction negative and modification positive.
(rK[-], mK[+]) Allows cloning of DNA without cleavage by endogenous restriction endonucleases. DNA prepared from hosts with this marker can efficiently transform rK[+ ]E. coli hosts.
hsdS20 Restriction negative and modification negative.
(rB[-,] mB[-]) Allows cloning of DNA without cleavage by endogenous restriction endonucleases . DNAprepared from hosts with this marker is unmethylated by the hsdS20 modificationsystem.
mcrA E. coli restriction system/ Mutation prevents McrA restriction of methylated DNA of sequence 5'-C*CGG (*=methylated).
mcrCB E. coli restriction system/ Mutation prevents McrCB restriction of methylated DNA of sequence 5'-G[5]*C, 5'-G[5h]*C, or 5'-G[N4]*C (*=methylated).
mrr E. coli restriction system/ Mutation prevents Mrr restriction of methylated DNA of sequence 5'-G*AC or 5'-C*AG (*=methylated). Mutation also prevents McrF restriction of methylated cytosine sequences.
Other Descriptions:
cm[r] Chloramphenicol resistance
kan[r] Kanamycin resistance
Tetracycline resistance
Streptomycin resistance
Indicates a deletion of genes following it.
Tn10
A transposon that normally codes for tetrTn5
A transposon that normally codes for kan[r]
spi[-] Refers to red[-]gam[-]mutant derivatives of lambda defined by their ability to form plaques on E. coli P2 lysogens.
Reference: Bachman, B.J. (1990) Microbiology Reviews 54: 130- 197.
Commonly used bacterial strains
C600 - F-, e14, mcrA, thr-1 supE44, thi-1, leuB6, lacY1, tonA21, [[lambda]] [-]
-for plating lambda (gt10) libraries, grows well in L broth, 2x TY, plate on NZYDT+Mg.
-Huynh, Young, and Davis (1985) DNA Cloning, Vol. 1, 56-110.
DH1 - F[-], recA1, endA1, gyrA96, thi-1, hsdR17 (rk[-], mk[+], supE44, relA1, [[lambda]][-]
]-for plasmid transformation, grows well on L broth and plates.
-Hanahan (1983) J. Mol. Biol. 166, 557-580.
XL1Blue-MRF' - D(mcrA)182, D(mcrCB-hsdSMR-mrr)172,endA1, supE44, thi-1, recA, gyrA96, relA1, lac, l-, [F'proAB, lac I[q]ZDM15, Tn10 (tet[r])] -For plating or glycerol stocks, grow in LB with 20 ug/ml of tetracycline. For transfection, grow in tryptone broth containing 10 mM MgSO4 and 0.2% maltose. (No antibiotic--Mg2+ interferes with tetracycline action.) For picking plaques, grow glycerol stock in LB to an O.D. of 0.5 at 600 nm (2.5 hours?). When at 0.5, add MgSO4 to a final concentration of 10 mM.
SURE Cells - Stratagene - e14(mcrA), D(mcrCB- hsdSMR-mrr)171, sbcC, recB, recJ, umuC::Tn5 (kan[r]), uvrC, supE44, lac, gyrA96, relA1, thi-1, end A1[F'proAB, lacI[q]DM15, Tn10(tet[r])]. An uncharacterized mutation enhances the a[-] complementation to give a more intense blue color on plates containing X-gal and IPTG.
GM272 - F[-], hsdR544 (rk[-], mk[-]), supE44, supF58, lacY1 or [[Delta]]lacIZY6, galK2, galT22, metB1m, trpR55, [[lambda]][-]
-for plasmid transformation, grows well in 2x TY, TYE, L broth and plates.
-Hanahan (1983) J. Mol. Biol. 166, 557-580.
HB101 - F[-], hsdS20 (rb[-], mb[-]), supE44, ara14, galK2, lacY1, proA2, rpsL20 (str[R]), xyl-5, mtl-1, [[lambda]][-], recA13, mcrA(+), mcrB(-)
-for plasmid transformation, grows well in 2x TY, TYE, L broth and plates.
-Raleigh and Wilson (1986) Proc. Natl. Acad. Sci. USA 83, 9070-9074.
JM101 - supE, thi, [[Delta]](lac-proAB), [F', traD36, proAB, lacIqZ[[Delta]]M15], restriction: (rk[+], mk[+]), mcrA+
-for M13 transformation, grow on minimal medium to maintain F episome, grows well in 2x TY, plate on TY or lambda agar.
-Yanisch-Perron et al. (1985) Gene 33, 103-119.
XL-1 blue recA1, endA1, gyrA96, thi, hsdR17 (rk[+], mk[+]), supE44, relA1, [[lambda]][-], lac, [F', proAB, lacIqZ[[Delta]]M15, Tn10 (tet[R])]
-for M13 and plasmid transformation, grow in 2x TY + 10 ug/ml Tet, plate on TY agar + 10 ug/ml Tet (Tet maintains F episome).
-Bullock, et al. (1987) BioTechniques 5, 376-379.
GM2929 - from B. Bachman, Yale E.coli Genetic Stock Center (CSGC#7080); M.Marinus strain; sex F[-];(ara-14, leuB6, fhuA13, lacY1, tsx-78, supE44, [glnV44], galK2, galT22, l[-], mcrA, dcm-6, hisG4,[Oc], rfbD1, rpsL136, dam-13::Tn9, xyl-5, mtl-1, recF143, thi-1, mcrB, hsdR2.)
MC1000 - (araD139, D[ara-leu]7679, galU, galK, D[lac]174, rpsL, thi-1). obtained from the McCarthy lab at the University of Oklahoma.
ED8767 (F-,e14-[mcrA],supE44,supF58,hsdS3[rB[-]mB[-]], recA56, galK2, galT22,metB1, lac-3 or lac3Y1 , obtained from Nora Heisterkamp and used as the host for abl and bcr cosmids.
Notes on Restriction/Modification Bacterial Strains:
1. EcoK (alternate=EcoB)-hsdRMS genes=attack DNA not protected by adenine methylation. (ED8767 is EcoK methylation minus). (1)
2. mcA (modified cytosine restriction), mcrBC, and mrr=methylation requiring systems that attack DNA only when it IS methylated (Ed8767 is mrr+, so methylated adenines will be restricted. Clone can carry methylation activity.) (1)
3. In general, it is best to use a strain lacking Mcr and Mrr systems when cloning genomic DNA from an organism with methylcytosine such as mammals, higher plants , and many prokaryotes. (2)
4. The use of D(mrr-hsd-mcrB) hosts=general methylation tolerance and suitability for clones with N6 methyladenine as well as 5mC (as with bacterial DNAs). (3)
5. XL1-Blue MRF'=D(mcrA)182, D(mcrCB-hsdSMR-mrr)172,endA1, supE44, thi-1, recA, gyrA96, relA1, lac, l-, [F' proAB, lacI[q]ZDM15, Tn10(tet[r]
REFERENCES:
1. Bickle, T. (1982) in Nucleases eds Linn, S.M. and Roberts, R.G. (CSH, NY) p. 95-100.
2. Erlich, M. and Wang, R.Y. (1981) Science 212, 1350-1357.
3. Woodcock, D.M. et al, (1989) Nucleic Acids Res., 17,3469-3478.


